Incidental Mutation 'R7173:Sptan1'
ID558395
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Namespectrin alpha, non-erythrocytic 1
Synonymsalpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29965560-30031451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29983209 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 138 (M138K)
Ref Sequence ENSEMBL: ENSMUSP00000109346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000113741] [ENSMUST00000129241]
Predicted Effect probably benign
Transcript: ENSMUST00000046257
AA Change: M138K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: M138K

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095083
AA Change: M138K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: M138K

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
AA Change: M138K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: M138K

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
AA Change: M138K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: M138K

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
AA Change: M138K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: M138K

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113741
AA Change: M150K

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109370
Gene: ENSMUSG00000057738
AA Change: M150K

DomainStartEndE-ValueType
Blast:SPEC 11 53 1e-20 BLAST
SPEC 59 136 3.03e-13 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: M138K

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29993956 critical splice donor site probably null
IGL00932:Sptan1 APN 2 30015610 missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30000071 splice site probably benign
IGL01070:Sptan1 APN 2 30014173 critical splice donor site probably null
IGL01625:Sptan1 APN 2 30026114 missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30018479 missense probably benign 0.12
IGL01795:Sptan1 APN 2 30018489 missense probably benign 0.07
IGL01982:Sptan1 APN 2 30019968 missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30013713 missense probably benign 0.43
IGL02158:Sptan1 APN 2 30030324 missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30030740 missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30016055 missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30018474 missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29998183 missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29978576 missense probably benign 0.03
IGL02725:Sptan1 APN 2 29996043 missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29991033 missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29986493 missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30025581 missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0094:Sptan1 UTSW 2 30006623 missense probably benign 0.37
R0230:Sptan1 UTSW 2 30010692 splice site probably benign
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0366:Sptan1 UTSW 2 29992752 splice site probably null
R0368:Sptan1 UTSW 2 29993915 missense probably benign 0.29
R0396:Sptan1 UTSW 2 29991033 missense probably damaging 1.00
R0423:Sptan1 UTSW 2 30028672 missense probably null
R0448:Sptan1 UTSW 2 30026810 missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30013848 splice site probably benign
R0580:Sptan1 UTSW 2 30007575 missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30013518 missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29980063 splice site probably null
R1352:Sptan1 UTSW 2 30021187 splice site probably benign
R1456:Sptan1 UTSW 2 29980203 critical splice donor site probably null
R1537:Sptan1 UTSW 2 30026022 missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 30027127 missense probably damaging 1.00
R1612:Sptan1 UTSW 2 30003336 missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29986420 missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29992001 splice site probably benign
R1879:Sptan1 UTSW 2 29995528 missense probably damaging 1.00
R1893:Sptan1 UTSW 2 30020460 missense probably damaging 0.98
R1914:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R1915:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R2022:Sptan1 UTSW 2 30007561 missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30002238 missense probably benign
R2103:Sptan1 UTSW 2 30030471 missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30018576 splice site probably benign
R2931:Sptan1 UTSW 2 30018488 missense probably benign
R3726:Sptan1 UTSW 2 30018419 missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30030025 missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30026588 missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30025569 missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30029709 intron probably benign
R4718:Sptan1 UTSW 2 30031062 missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29996435 missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30011042 missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29978443 missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29993724 intron probably benign
R5181:Sptan1 UTSW 2 29993724 intron probably benign
R5383:Sptan1 UTSW 2 30011328 missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29986492 nonsense probably null
R5592:Sptan1 UTSW 2 29986719 intron probably benign
R5639:Sptan1 UTSW 2 29990993 nonsense probably null
R5801:Sptan1 UTSW 2 30030601 splice site probably null
R5947:Sptan1 UTSW 2 29994367 critical splice donor site probably null
R6056:Sptan1 UTSW 2 29996782 missense probably benign 0.36
R6090:Sptan1 UTSW 2 29993887 missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30004523 missense probably benign 0.01
R6254:Sptan1 UTSW 2 30007549 missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30018515 missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30030973 missense probably damaging 0.99
R7248:Sptan1 UTSW 2 30002299 missense probably benign 0.10
R7282:Sptan1 UTSW 2 29986929 missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29980197 missense probably damaging 1.00
X0028:Sptan1 UTSW 2 30020030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGAGCTGATGGTTACCCC -3'
(R):5'- CTGCACTAACACTGCCTATTAAGG -3'

Sequencing Primer
(F):5'- CAGACATGGTTCTTCTGTGAAGCC -3'
(R):5'- GCAGACCACAGGGAGATTCCTTC -3'
Posted On2019-06-26