Incidental Mutation 'R0588:Zdhhc7'
ID55840
Institutional Source Beutler Lab
Gene Symbol Zdhhc7
Ensembl Gene ENSMUSG00000031823
Gene Namezinc finger, DHHC domain containing 7
Synonyms
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0588 (G1)
Quality Score190
Status Validated
Chromosome8
Chromosomal Location120080890-120101482 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 120083367 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034280] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000034280
SMART Domains Protein: ENSMUSP00000034280
Gene: ENSMUSG00000031823

DomainStartEndE-ValueType
low complexity region 25 31 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Pfam:zf-DHHC 129 258 9.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124044
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150444
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Other mutations in Zdhhc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Zdhhc7 APN 8 120087923 missense probably benign
IGL01988:Zdhhc7 APN 8 120082590 missense probably benign 0.00
IGL03407:Zdhhc7 APN 8 120085392 missense probably damaging 0.98
R0362:Zdhhc7 UTSW 8 120086647 missense probably null 0.32
R0629:Zdhhc7 UTSW 8 120088046 missense possibly damaging 0.60
R1224:Zdhhc7 UTSW 8 120082572 missense probably benign
R1317:Zdhhc7 UTSW 8 120084900 missense probably benign 0.04
R1796:Zdhhc7 UTSW 8 120085418 missense probably benign 0.04
R5891:Zdhhc7 UTSW 8 120084900 missense probably benign 0.04
R6495:Zdhhc7 UTSW 8 120086656 missense probably benign 0.19
R6711:Zdhhc7 UTSW 8 120083327 missense probably benign 0.04
R6833:Zdhhc7 UTSW 8 120084924 missense probably damaging 1.00
R7083:Zdhhc7 UTSW 8 120085427 missense probably damaging 1.00
R7743:Zdhhc7 UTSW 8 120086728 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCTGAGACCCACTGAGTTCTGACC -3'
(R):5'- GCTTGCCTGCCATTGTAAAGCTCTG -3'

Sequencing Primer
(F):5'- GGAACTATGCTGCCCCAATG -3'
(R):5'- TATAGTCCCCAGTGCGGTAAG -3'
Posted On2013-07-11