Incidental Mutation 'R7173:Gdap1l1'
ID558404
Institutional Source Beutler Lab
Gene Symbol Gdap1l1
Ensembl Gene ENSMUSG00000017943
Gene Nameganglioside-induced differentiation-associated protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location163438476-163455324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 163438688 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 48 (V48G)
Ref Sequence ENSEMBL: ENSMUSP00000105048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018087] [ENSMUST00000109420] [ENSMUST00000109421] [ENSMUST00000137070]
Predicted Effect probably damaging
Transcript: ENSMUST00000018087
AA Change: V48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018087
Gene: ENSMUSG00000017943
AA Change: V48G

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109420
AA Change: V48G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105047
Gene: ENSMUSG00000017943
AA Change: V48G

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109421
AA Change: V48G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105048
Gene: ENSMUSG00000017943
AA Change: V48G

DomainStartEndE-ValueType
Pfam:GST_N 45 123 1.2e-8 PFAM
Pfam:GST_N_3 49 129 3.3e-10 PFAM
Pfam:GST_N_2 62 124 7.6e-9 PFAM
Pfam:GST_C_2 182 307 8.2e-9 PFAM
Pfam:GST_C 201 311 3.4e-8 PFAM
transmembrane domain 343 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137070
AA Change: V48G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119421
Gene: ENSMUSG00000017943
AA Change: V48G

DomainStartEndE-ValueType
Pfam:GST_N 45 120 2.3e-8 PFAM
Pfam:GST_N_3 49 126 1.6e-13 PFAM
Pfam:GST_N_2 55 121 1.1e-9 PFAM
Pfam:GST_C_2 142 246 3.1e-8 PFAM
Pfam:GST_C 146 251 1.6e-6 PFAM
Meta Mutation Damage Score 0.1728 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Gdap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gdap1l1 APN 2 163453668 missense probably damaging 1.00
IGL02171:Gdap1l1 APN 2 163447550 missense possibly damaging 0.78
IGL02335:Gdap1l1 APN 2 163447595 missense possibly damaging 0.50
F5770:Gdap1l1 UTSW 2 163447486 intron probably benign
R0091:Gdap1l1 UTSW 2 163446091 missense probably damaging 1.00
R0165:Gdap1l1 UTSW 2 163451499 critical splice acceptor site probably null
R0242:Gdap1l1 UTSW 2 163447653 nonsense probably null
R1577:Gdap1l1 UTSW 2 163438604 missense probably damaging 0.96
R2022:Gdap1l1 UTSW 2 163447597 missense probably benign 0.04
R4960:Gdap1l1 UTSW 2 163453859 missense probably benign 0.00
R6027:Gdap1l1 UTSW 2 163451611 missense possibly damaging 0.57
R6292:Gdap1l1 UTSW 2 163451507 missense probably damaging 1.00
R6678:Gdap1l1 UTSW 2 163438654 missense probably benign
R7034:Gdap1l1 UTSW 2 163446145 missense probably damaging 1.00
R7195:Gdap1l1 UTSW 2 163446130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGGCCATGTGATGCTGG -3'
(R):5'- AACGAGGCCTAAGGAGATGCTC -3'

Sequencing Primer
(F):5'- ATGTGATGCTGGGCGCC -3'
(R):5'- CCTCAGGACAGTTCCCT -3'
Posted On2019-06-26