Incidental Mutation 'R7173:Alpk1'
ID558405
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Namealpha-kinase 1
Synonyms8430410J10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location127670310-127780527 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 127684375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 74 (Y74*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
Predicted Effect probably null
Transcript: ENSMUST00000029662
AA Change: Y254*
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: Y254*

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159720
AA Change: Y74*
Predicted Effect probably null
Transcript: ENSMUST00000198955
AA Change: Y254*
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: Y254*

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 unclassified probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3803:Alpk1 UTSW 3 127679837 missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127677716 missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127685320 splice site probably benign
R5169:Alpk1 UTSW 3 127671101 missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R5940:Alpk1 UTSW 3 127670946 missense probably benign
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAGGACCTACTAGAGCTGCTC -3'
(R):5'- CTCAGTCCTGGTGATGTTCAG -3'

Sequencing Primer
(F):5'- GAGCTGCTCCCATTAATCTAGGAG -3'
(R):5'- CCTGGTGATGTTCAGTCCAAAAG -3'
Posted On2019-06-26