Mutagenetix > Incidental Mutations

Incidental Mutation 'R7173:Rere'

558409

Institutional Source

Beutler Lab

Gene Symbol

Rere

Ensembl Gene

ENSMUSG00000039852

Gene Name

arginine glutamic acid dipeptide (RE) repeats

Synonyms

1110033A15Rik, eyes3, Atr2, eye, atrophin-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7173 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150281646-150621966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 150468738 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 129 (R129H)

Ref Sequence

ENSEMBL: ENSMUSP00000115385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105682] [ENSMUST00000131600]

Predicted Effect

unknown
Transcript: ENSMUST00000105682
AA Change: R189H

SMART Domains

Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: R189H

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	52	65	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
BAH	103	283	3.52e-13	SMART
ELM2	286	338	1.67e-13	SMART
SANT	392	441	1.8e-6	SMART
low complexity region	444	461	N/A	INTRINSIC
ZnF_GATA	501	552	1.94e-15	SMART
Pfam:Atrophin-1	568	1557	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000131600
AA Change: R129H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115385
Gene: ENSMUSG00000039852
AA Change: R129H

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	34	47	N/A	INTRINSIC
low complexity region	55	67	N/A	INTRINSIC
Pfam:BAH	85	178	2.1e-9	PFAM

Meta Mutation Damage Score

0.8652

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	C	T	15: 84,949,647	V403I	possibly damaging	Het
Actn1	G	A	12: 80,177,259	R475C	possibly damaging	Het
Adam11	T	C	11: 102,771,931	L191P	possibly damaging	Het
Adam21	G	T	12: 81,559,234	Q585K	probably benign	Het
Akap3	T	C	6: 126,864,766	V116A	probably benign	Het
Alpk1	A	T	3: 127,684,375	Y74*	probably null	Het
Alx4	G	T	2: 93,642,857	G67C	possibly damaging	Het
Ankrd17	A	T	5: 90,260,117	C1414S	possibly damaging	Het
Ankrd44	T	C	1: 54,766,391	D170G	probably damaging	Het
Arpc2	T	A	1: 74,264,372	M266K	probably damaging	Het
Atp12a	A	T	14: 56,384,380	N794I	probably damaging	Het
Cabin1	A	G	10: 75,746,562	L340P	probably benign	Het
Ccer1	A	T	10: 97,693,355		probably benign	Het
Cfap73	A	T	5: 120,634,214	Y8N	probably damaging	Het
Cln3	T	C	7: 126,579,417	T173A	probably damaging	Het
Cxcl3	A	T	5: 90,786,149		probably benign	Het
Cyp2c66	G	C	19: 39,170,957	C284S	probably benign	Het
Dnajc22	T	C	15: 99,101,306	V124A	probably benign	Het
Dync1h1	C	G	12: 110,601,739	D45E	probably benign	Het
Elmod3	A	T	6: 72,577,252		probably null	Het
Enpp3	A	C	10: 24,774,047	V827G	probably damaging	Het
Esyt2	T	C	12: 116,363,534	I574T	probably benign	Het
Ext2	A	T	2: 93,813,612	I108N	probably damaging	Het
Fam186a	T	C	15: 99,945,650	I904M	unknown	Het
Fam192a	A	T	8: 94,588,858	F15L	probably damaging	Het
Fmnl2	T	C	2: 53,114,190	I638T	unknown	Het
Fndc3c1	G	C	X: 106,435,073	L724V	possibly damaging	Het
Fras1	G	T	5: 96,778,078	A3714S	probably damaging	Het
Fsd1	C	A	17: 55,996,696	R479S	possibly damaging	Het
Gaa	C	T	11: 119,278,991	L624F	probably damaging	Het
Galnt2	G	A	8: 124,305,553	V86I	probably benign	Het
Gdap1l1	T	G	2: 163,438,688	V48G	probably damaging	Het
Gm10549	A	G	18: 33,464,409	T83A	unknown	Het
Gm11437	T	G	11: 84,164,548	T81P	probably benign	Het
Gm16253	T	C	3: 96,580,663		probably null	Het
Gm4788	C	A	1: 139,731,677	E705*	probably null	Het
Gprc6a	A	T	10: 51,628,499	M83K	probably benign	Het
Grik5	T	C	7: 25,068,162	D31G	probably damaging	Het
Hcrtr2	A	G	9: 76,259,731	L108P	probably damaging	Het
Herc2	T	A	7: 56,203,827	L3689Q	probably damaging	Het
Igf2bp1	T	C	11: 95,968,464	M407V	probably benign	Het
Irgq	A	T	7: 24,533,760	E342V	probably damaging	Het
Itih2	A	T	2: 10,105,163	I593N	probably damaging	Het
Ivd	G	T	2: 118,871,389	G101C	probably damaging	Het
Jakmip1	G	A	5: 37,091,364	G123S	probably damaging	Het
Kif14	T	A	1: 136,479,170	I580N	probably damaging	Het
Kmt2e	A	T	5: 23,464,857	Y114F	probably damaging	Het
Ly6g5b	C	A	17: 35,114,704	C99F	probably damaging	Het
Map3k20	C	T	2: 72,441,414	P629S	probably benign	Het
Mpl	A	G	4: 118,448,544		probably null	Het
Muc4	T	C	16: 32,762,488	F476L	probably damaging	Het
Mup18	T	C	4: 61,671,962	T110A	probably benign	Het
Nlrp9a	A	G	7: 26,558,178	D407G	probably benign	Het
Nmur1	G	A	1: 86,386,468	R359C	probably benign	Het
Olfr206	T	C	16: 59,345,147	T185A	probably benign	Het
Olfr488	C	T	7: 108,255,748	C130Y	possibly damaging	Het
Panx3	A	T	9: 37,661,300	M318K	probably damaging	Het
Pcnx	T	C	12: 81,953,003		probably null	Het
Pcsk5	T	C	19: 17,477,877	Y1063C	possibly damaging	Het
Rpgrip1	A	G	14: 52,112,176	Y7C	possibly damaging	Het
Serpina6	T	C	12: 103,646,994	N349S	possibly damaging	Het
Slc10a1	T	G	12: 80,955,976	E296A	probably damaging	Het
Slc2a9	A	T	5: 38,452,871		probably null	Het
Sptan1	T	A	2: 29,983,209	M138K	probably benign	Het
Tbl3	T	C	17: 24,705,259	T175A	probably benign	Het
Tbrg4	T	C	11: 6,620,810	T221A	possibly damaging	Het
Tenm2	T	C	11: 36,041,551	T1739A	probably damaging	Het
Tmed5	T	C	5: 108,132,321	D35G	probably benign	Het
Tnfsf15	A	T	4: 63,729,652	S250R	probably damaging	Het
Tnpo2	G	T	8: 85,055,078	V830F	probably benign	Het
Ttbk2	G	T	2: 120,740,111	S1187Y	probably damaging	Het
Ttn	G	A	2: 76,794,685	T15183M	possibly damaging	Het
Tubgcp3	T	C	8: 12,639,259		probably null	Het
Vmn1r38	T	C	6: 66,776,294	I279M	possibly damaging	Het
Vmn1r49	A	T	6: 90,072,268	Y251N	possibly damaging	Het
Vmn1r66	C	T	7: 10,274,555	V184I	probably benign	Het
Vmn2r26	T	A	6: 124,061,296	M610K	probably benign	Het
Xrn2	C	T	2: 147,042,093	P591S	probably damaging	Het

Other mutations in Rere

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Rere	APN	4	150619463	missense	probably damaging	1.00
IGL01465:Rere	APN	4	150509994	missense	unknown
IGL01523:Rere	APN	4	150615555	missense	possibly damaging	0.93
IGL01688:Rere	APN	4	150618436	missense	probably damaging	1.00
IGL02057:Rere	APN	4	150614832	unclassified	probably benign
IGL02621:Rere	APN	4	150613812	unclassified	probably benign
IGL02672:Rere	APN	4	150510026	missense	unknown
R0116:Rere	UTSW	4	150616976	missense	probably benign	0.18
R0119:Rere	UTSW	4	150615322	unclassified	probably benign
R0344:Rere	UTSW	4	150610981	unclassified	probably benign
R0504:Rere	UTSW	4	150615322	unclassified	probably benign
R0630:Rere	UTSW	4	150619088	missense	probably damaging	1.00
R0961:Rere	UTSW	4	150615372	unclassified	probably benign
R1164:Rere	UTSW	4	150534884	missense	unknown
R1424:Rere	UTSW	4	150617038	missense	probably damaging	1.00
R1542:Rere	UTSW	4	150615942	missense	probably damaging	1.00
R1652:Rere	UTSW	4	150612065	unclassified	probably benign
R1953:Rere	UTSW	4	150616837	missense	probably damaging	1.00
R1959:Rere	UTSW	4	150468790	missense	probably benign	0.23
R1966:Rere	UTSW	4	150616873	missense	probably damaging	1.00
R1975:Rere	UTSW	4	150615733	missense	probably damaging	0.99
R2070:Rere	UTSW	4	150614590	unclassified	probably benign
R2115:Rere	UTSW	4	150612561	unclassified	probably benign
R2144:Rere	UTSW	4	150616931	missense	probably damaging	0.99
R2270:Rere	UTSW	4	150477380	missense	unknown
R2969:Rere	UTSW	4	150570216	missense	unknown
R3699:Rere	UTSW	4	150477362	critical splice acceptor site	probably null
R3723:Rere	UTSW	4	150468795	missense	probably damaging	1.00
R3826:Rere	UTSW	4	150470328	missense	probably benign	0.42
R4234:Rere	UTSW	4	150617405	missense	probably damaging	1.00
R4512:Rere	UTSW	4	150477452	missense	unknown
R4798:Rere	UTSW	4	150615167	unclassified	probably benign
R4883:Rere	UTSW	4	150616053	missense	probably damaging	0.98
R4914:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4916:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4917:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4918:Rere	UTSW	4	150619144	missense	probably damaging	1.00
R4966:Rere	UTSW	4	150613816	unclassified	probably benign
R5172:Rere	UTSW	4	150570269	missense	unknown
R5643:Rere	UTSW	4	150617243	missense	probably damaging	1.00
R6058:Rere	UTSW	4	150468798	missense	probably damaging	1.00
R7112:Rere	UTSW	4	150406604	missense	probably benign
R7190:Rere	UTSW	4	150610953	missense	unknown
R7699:Rere	UTSW	4	150617098	missense
R7990:Rere	UTSW	4	150614870	missense	unknown
R8070:Rere	UTSW	4	150617375	missense	probably damaging	1.00
R8101:Rere	UTSW	4	150617339	missense	probably damaging	1.00
R8103:Rere	UTSW	4	150617339	missense	probably damaging	1.00
R8215:Rere	UTSW	4	150616967	missense	possibly damaging	0.95
R8254:Rere	UTSW	4	150612672	missense	unknown
R8348:Rere	UTSW	4	150619196	missense	probably damaging	1.00
R8448:Rere	UTSW	4	150619196	missense	probably damaging	1.00
R8725:Rere	UTSW	4	150617335	nonsense	probably null
R8790:Rere	UTSW	4	150508875	missense	unknown
Z1176:Rere	UTSW	4	150468783	missense	probably damaging	1.00
Z1177:Rere	UTSW	4	150615811	missense

Predicted Primers

PCR Primer
(F):5'- CTCTGAGATGAGCAGTTGCAGG -3'
(R):5'- GCGATGCTCTTTATTGCAAGTTC -3'

Sequencing Primer
(F):5'- TTGCAGCAGGGTTCCGATC -3'
(R):5'- CTCTTTATTGCAAGTTCTTTTGAGAG -3'

Posted On

2019-06-26