Mutagenetix > Incidental Mutations

Incidental Mutation 'R7173:Kmt2e'

558410

Institutional Source

Beutler Lab

Gene Symbol

Kmt2e

Ensembl Gene

ENSMUSG00000029004

Gene Name

lysine (K)-specific methyltransferase 2E

Synonyms

D230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7173 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23434441-23504235 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23464857 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 114 (Y114F)

Ref Sequence

ENSEMBL: ENSMUSP00000092569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094962
AA Change: Y114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: Y114F

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000115128
AA Change: Y114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: Y114F

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	4.25e-8	SMART
SET	328	453	2.13e-26	SMART
low complexity region	487	503	N/A	INTRINSIC
low complexity region	569	582	N/A	INTRINSIC
low complexity region	854	867	N/A	INTRINSIC
low complexity region	882	908	N/A	INTRINSIC
low complexity region	933	945	N/A	INTRINSIC
low complexity region	951	960	N/A	INTRINSIC
low complexity region	1184	1197	N/A	INTRINSIC
low complexity region	1214	1237	N/A	INTRINSIC
low complexity region	1294	1312	N/A	INTRINSIC
low complexity region	1348	1367	N/A	INTRINSIC
internal_repeat_1	1434	1496	6.13e-7	PROSPERO
low complexity region	1506	1518	N/A	INTRINSIC
low complexity region	1625	1641	N/A	INTRINSIC
low complexity region	1677	1705	N/A	INTRINSIC
low complexity region	1720	1731	N/A	INTRINSIC
internal_repeat_1	1783	1842	6.13e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000196889
AA Change: Y114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: Y114F

Domain	Start	End	E-Value	Type
low complexity region	23	38	N/A	INTRINSIC
low complexity region	48	55	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
low complexity region	100	109	N/A	INTRINSIC
PHD	120	164	2.7e-10	SMART
Blast:SET	216	327	6e-61	BLAST
Blast:SET	328	377	3e-26	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	C	T	15: 84,949,647	V403I	possibly damaging	Het
Actn1	G	A	12: 80,177,259	R475C	possibly damaging	Het
Adam11	T	C	11: 102,771,931	L191P	possibly damaging	Het
Adam21	G	T	12: 81,559,234	Q585K	probably benign	Het
Akap3	T	C	6: 126,864,766	V116A	probably benign	Het
Alpk1	A	T	3: 127,684,375	Y74*	probably null	Het
Alx4	G	T	2: 93,642,857	G67C	possibly damaging	Het
Ankrd17	A	T	5: 90,260,117	C1414S	possibly damaging	Het
Ankrd44	T	C	1: 54,766,391	D170G	probably damaging	Het
Arpc2	T	A	1: 74,264,372	M266K	probably damaging	Het
Atp12a	A	T	14: 56,384,380	N794I	probably damaging	Het
Cabin1	A	G	10: 75,746,562	L340P	probably benign	Het
Ccer1	A	T	10: 97,693,355		probably benign	Het
Cfap73	A	T	5: 120,634,214	Y8N	probably damaging	Het
Cln3	T	C	7: 126,579,417	T173A	probably damaging	Het
Cxcl3	A	T	5: 90,786,149		probably benign	Het
Cyp2c66	G	C	19: 39,170,957	C284S	probably benign	Het
Dnajc22	T	C	15: 99,101,306	V124A	probably benign	Het
Dync1h1	C	G	12: 110,601,739	D45E	probably benign	Het
Elmod3	A	T	6: 72,577,252		probably null	Het
Enpp3	A	C	10: 24,774,047	V827G	probably damaging	Het
Esyt2	T	C	12: 116,363,534	I574T	probably benign	Het
Ext2	A	T	2: 93,813,612	I108N	probably damaging	Het
Fam186a	T	C	15: 99,945,650	I904M	unknown	Het
Fam192a	A	T	8: 94,588,858	F15L	probably damaging	Het
Fmnl2	T	C	2: 53,114,190	I638T	unknown	Het
Fndc3c1	G	C	X: 106,435,073	L724V	possibly damaging	Het
Fras1	G	T	5: 96,778,078	A3714S	probably damaging	Het
Fsd1	C	A	17: 55,996,696	R479S	possibly damaging	Het
Gaa	C	T	11: 119,278,991	L624F	probably damaging	Het
Galnt2	G	A	8: 124,305,553	V86I	probably benign	Het
Gdap1l1	T	G	2: 163,438,688	V48G	probably damaging	Het
Gm10549	A	G	18: 33,464,409	T83A	unknown	Het
Gm11437	T	G	11: 84,164,548	T81P	probably benign	Het
Gm16253	T	C	3: 96,580,663		probably null	Het
Gm4788	C	A	1: 139,731,677	E705*	probably null	Het
Gprc6a	A	T	10: 51,628,499	M83K	probably benign	Het
Grik5	T	C	7: 25,068,162	D31G	probably damaging	Het
Hcrtr2	A	G	9: 76,259,731	L108P	probably damaging	Het
Herc2	T	A	7: 56,203,827	L3689Q	probably damaging	Het
Igf2bp1	T	C	11: 95,968,464	M407V	probably benign	Het
Irgq	A	T	7: 24,533,760	E342V	probably damaging	Het
Itih2	A	T	2: 10,105,163	I593N	probably damaging	Het
Ivd	G	T	2: 118,871,389	G101C	probably damaging	Het
Jakmip1	G	A	5: 37,091,364	G123S	probably damaging	Het
Kif14	T	A	1: 136,479,170	I580N	probably damaging	Het
Ly6g5b	C	A	17: 35,114,704	C99F	probably damaging	Het
Map3k20	C	T	2: 72,441,414	P629S	probably benign	Het
Mpl	A	G	4: 118,448,544		probably null	Het
Muc4	T	C	16: 32,762,488	F476L	probably damaging	Het
Mup18	T	C	4: 61,671,962	T110A	probably benign	Het
Nlrp9a	A	G	7: 26,558,178	D407G	probably benign	Het
Nmur1	G	A	1: 86,386,468	R359C	probably benign	Het
Olfr206	T	C	16: 59,345,147	T185A	probably benign	Het
Olfr488	C	T	7: 108,255,748	C130Y	possibly damaging	Het
Panx3	A	T	9: 37,661,300	M318K	probably damaging	Het
Pcnx	T	C	12: 81,953,003		probably null	Het
Pcsk5	T	C	19: 17,477,877	Y1063C	possibly damaging	Het
Rere	G	A	4: 150,468,738	R129H	probably damaging	Het
Rpgrip1	A	G	14: 52,112,176	Y7C	possibly damaging	Het
Serpina6	T	C	12: 103,646,994	N349S	possibly damaging	Het
Slc10a1	T	G	12: 80,955,976	E296A	probably damaging	Het
Slc2a9	A	T	5: 38,452,871		probably null	Het
Sptan1	T	A	2: 29,983,209	M138K	probably benign	Het
Tbl3	T	C	17: 24,705,259	T175A	probably benign	Het
Tbrg4	T	C	11: 6,620,810	T221A	possibly damaging	Het
Tenm2	T	C	11: 36,041,551	T1739A	probably damaging	Het
Tmed5	T	C	5: 108,132,321	D35G	probably benign	Het
Tnfsf15	A	T	4: 63,729,652	S250R	probably damaging	Het
Tnpo2	G	T	8: 85,055,078	V830F	probably benign	Het
Ttbk2	G	T	2: 120,740,111	S1187Y	probably damaging	Het
Ttn	G	A	2: 76,794,685	T15183M	possibly damaging	Het
Tubgcp3	T	C	8: 12,639,259		probably null	Het
Vmn1r38	T	C	6: 66,776,294	I279M	possibly damaging	Het
Vmn1r49	A	T	6: 90,072,268	Y251N	possibly damaging	Het
Vmn1r66	C	T	7: 10,274,555	V184I	probably benign	Het
Vmn2r26	T	A	6: 124,061,296	M610K	probably benign	Het
Xrn2	C	T	2: 147,042,093	P591S	probably damaging	Het

Other mutations in Kmt2e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Kmt2e	APN	5	23492358	missense	probably damaging	0.99
IGL01330:Kmt2e	APN	5	23497948	missense	possibly damaging	0.95
IGL01457:Kmt2e	APN	5	23502019	missense	possibly damaging	0.62
IGL01691:Kmt2e	APN	5	23497091	missense	probably benign
IGL02274:Kmt2e	APN	5	23500760	missense	probably benign	0.00
IGL02934:Kmt2e	APN	5	23497884	missense	probably damaging	0.97
IGL02964:Kmt2e	APN	5	23467100	splice site	probably benign
IGL03011:Kmt2e	APN	5	23497542	missense	probably damaging	1.00
IGL03291:Kmt2e	APN	5	23499291	missense	probably damaging	1.00
R0035:Kmt2e	UTSW	5	23485621	splice site	probably benign
R0446:Kmt2e	UTSW	5	23497534	splice site	probably null
R0498:Kmt2e	UTSW	5	23478972	nonsense	probably null
R0699:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0701:Kmt2e	UTSW	5	23473583	missense	probably benign	0.01
R0761:Kmt2e	UTSW	5	23503034	nonsense	probably null
R1110:Kmt2e	UTSW	5	23502655	missense	probably damaging	1.00
R1295:Kmt2e	UTSW	5	23502404	missense	probably damaging	0.99
R1432:Kmt2e	UTSW	5	23450321	missense	probably benign	0.39
R1495:Kmt2e	UTSW	5	23499327	missense	possibly damaging	0.83
R1505:Kmt2e	UTSW	5	23500535	missense	probably null	0.01
R1623:Kmt2e	UTSW	5	23482502	missense	probably damaging	1.00
R1675:Kmt2e	UTSW	5	23482453	nonsense	probably null
R1691:Kmt2e	UTSW	5	23464849	missense	probably damaging	1.00
R1778:Kmt2e	UTSW	5	23492364	missense	probably damaging	1.00
R1820:Kmt2e	UTSW	5	23473547	missense	probably damaging	1.00
R1846:Kmt2e	UTSW	5	23499486	intron	probably benign
R1912:Kmt2e	UTSW	5	23492395	missense	probably benign	0.07
R2070:Kmt2e	UTSW	5	23501995	missense	probably benign
R2195:Kmt2e	UTSW	5	23502196	splice site	probably null
R2571:Kmt2e	UTSW	5	23501887	missense	probably benign	0.08
R3901:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3902:Kmt2e	UTSW	5	23501642	missense	probably benign	0.02
R3905:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3906:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3909:Kmt2e	UTSW	5	23501626	missense	probably benign	0.01
R3956:Kmt2e	UTSW	5	23496025	missense	probably benign	0.00
R4242:Kmt2e	UTSW	5	23502822	unclassified	probably benign
R4299:Kmt2e	UTSW	5	23464914	missense	probably damaging	1.00
R4448:Kmt2e	UTSW	5	23464790	missense	possibly damaging	0.80
R4528:Kmt2e	UTSW	5	23473558	missense	possibly damaging	0.69
R4574:Kmt2e	UTSW	5	23492407	missense	possibly damaging	0.60
R4719:Kmt2e	UTSW	5	23492315	missense	probably damaging	1.00
R4754:Kmt2e	UTSW	5	23482441	missense	possibly damaging	0.88
R4787:Kmt2e	UTSW	5	23463083	missense	possibly damaging	0.65
R4812:Kmt2e	UTSW	5	23502587	missense	possibly damaging	0.86
R4853:Kmt2e	UTSW	5	23502341	missense	probably damaging	1.00
R5138:Kmt2e	UTSW	5	23502695	missense	probably damaging	0.99
R5306:Kmt2e	UTSW	5	23499333	missense	probably damaging	0.98
R5659:Kmt2e	UTSW	5	23497807	missense	probably damaging	0.99
R5907:Kmt2e	UTSW	5	23464706	missense	probably damaging	1.00
R5920:Kmt2e	UTSW	5	23499442	missense	possibly damaging	0.50
R6280:Kmt2e	UTSW	5	23499516	missense	possibly damaging	0.48
R6353:Kmt2e	UTSW	5	23493245	missense	probably damaging	1.00
R6375:Kmt2e	UTSW	5	23499519	missense	probably benign
R6553:Kmt2e	UTSW	5	23463026	missense	probably damaging	0.99
R6572:Kmt2e	UTSW	5	23497581	missense	possibly damaging	0.66
R6678:Kmt2e	UTSW	5	23499295	missense	possibly damaging	0.54
R6791:Kmt2e	UTSW	5	23499476	intron	probably benign
R6792:Kmt2e	UTSW	5	23499476	intron	probably benign
R6794:Kmt2e	UTSW	5	23499476	intron	probably benign
R6797:Kmt2e	UTSW	5	23482507	missense	possibly damaging	0.82
R6947:Kmt2e	UTSW	5	23497545	missense	probably damaging	1.00
R7023:Kmt2e	UTSW	5	23500487	missense	possibly damaging	0.46
R7036:Kmt2e	UTSW	5	23478743	missense	probably null	1.00
R7202:Kmt2e	UTSW	5	23492294	unclassified	probably benign
R7563:Kmt2e	UTSW	5	23500273	missense	probably damaging	1.00
R7571:Kmt2e	UTSW	5	23478587	missense	probably damaging	1.00
R7604:Kmt2e	UTSW	5	23501765	missense	not run
R7722:Kmt2e	UTSW	5	23497018	missense	probably benign	0.00
R7758:Kmt2e	UTSW	5	23496070	missense	possibly damaging	0.92
R7794:Kmt2e	UTSW	5	23464716	missense	probably damaging	1.00
R8137:Kmt2e	UTSW	5	23501954	missense	probably damaging	1.00
R8341:Kmt2e	UTSW	5	23499453	missense	probably damaging	0.98
R8383:Kmt2e	UTSW	5	23485541	missense	probably benign	0.08
R8400:Kmt2e	UTSW	5	23497092	missense	probably benign	0.17
R8546:Kmt2e	UTSW	5	23481244	missense	probably damaging	1.00
R8750:Kmt2e	UTSW	5	23493217	missense	probably benign
R8786:Kmt2e	UTSW	5	23464866	missense	probably damaging	1.00
RF026:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF028:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF040:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
RF042:Kmt2e	UTSW	5	23478509	critical splice acceptor site	probably benign
Z1177:Kmt2e	UTSW	5	23481208	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGACTTTCATCTACTAGACAGTGAC -3'
(R):5'- CAAAAGTGACCTTACTACCATTTCC -3'

Sequencing Primer
(F):5'- AGTGACATTAACTTATTACCACTGTG -3'
(R):5'- CTTTAATCCTAAGCACTCGGGAGG -3'

Posted On

2019-06-26