Mutagenetix > Incidental Mutation

Incidental Mutation 'R7173:Grik5'

558424

Institutional Source

Beutler Lab

Gene Symbol

Grik5

Ensembl Gene

ENSMUSG00000003378

Gene Name

glutamate receptor, ionotropic, kainate 5 (gamma 2)

Synonyms

GluRgamma2, KA2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R7173 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25009849-25072346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25068162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 31 (D31G)

Ref Sequence

ENSEMBL: ENSMUSP00000003468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]

AlphaFold

Q61626

Predicted Effect

probably damaging
Transcript: ENSMUST00000003468
AA Change: D31G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: D31G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	40	381	3.4e-64	PFAM
PBPe	416	785	3.7e-122	SMART
Lig_chan-Glu_bd	426	490	1.65e-29	SMART
transmembrane domain	804	823	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	893	921	N/A	INTRINSIC
low complexity region	962	973	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205328
AA Change: D31G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206134
AA Change: D31G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.7403

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	C	T	15: 84,949,647	V403I	possibly damaging	Het
Actn1	G	A	12: 80,177,259	R475C	possibly damaging	Het
Adam11	T	C	11: 102,771,931	L191P	possibly damaging	Het
Adam21	G	T	12: 81,559,234	Q585K	probably benign	Het
Akap3	T	C	6: 126,864,766	V116A	probably benign	Het
Alpk1	A	T	3: 127,684,375	Y74*	probably null	Het
Alx4	G	T	2: 93,642,857	G67C	possibly damaging	Het
Ankrd17	A	T	5: 90,260,117	C1414S	possibly damaging	Het
Ankrd44	T	C	1: 54,766,391	D170G	probably damaging	Het
Arpc2	T	A	1: 74,264,372	M266K	probably damaging	Het
Atp12a	A	T	14: 56,384,380	N794I	probably damaging	Het
Cabin1	A	G	10: 75,746,562	L340P	probably benign	Het
Ccer1	A	T	10: 97,693,355		probably benign	Het
Cfap73	A	T	5: 120,634,214	Y8N	probably damaging	Het
Cln3	T	C	7: 126,579,417	T173A	probably damaging	Het
Cxcl3	A	T	5: 90,786,149		probably benign	Het
Cyp2c66	G	C	19: 39,170,957	C284S	probably benign	Het
Dnajc22	T	C	15: 99,101,306	V124A	probably benign	Het
Dync1h1	C	G	12: 110,601,739	D45E	probably benign	Het
Elmod3	A	T	6: 72,577,252		probably null	Het
Enpp3	A	C	10: 24,774,047	V827G	probably damaging	Het
Esyt2	T	C	12: 116,363,534	I574T	probably benign	Het
Ext2	A	T	2: 93,813,612	I108N	probably damaging	Het
Fam186a	T	C	15: 99,945,650	I904M	unknown	Het
Fam192a	A	T	8: 94,588,858	F15L	probably damaging	Het
Fmnl2	T	C	2: 53,114,190	I638T	unknown	Het
Fndc3c1	G	C	X: 106,435,073	L724V	possibly damaging	Het
Fras1	G	T	5: 96,778,078	A3714S	probably damaging	Het
Fsd1	C	A	17: 55,996,696	R479S	possibly damaging	Het
Gaa	C	T	11: 119,278,991	L624F	probably damaging	Het
Galnt2	G	A	8: 124,305,553	V86I	probably benign	Het
Gdap1l1	T	G	2: 163,438,688	V48G	probably damaging	Het
Gm10549	A	G	18: 33,464,409	T83A	unknown	Het
Gm11437	T	G	11: 84,164,548	T81P	probably benign	Het
Gm16253	T	C	3: 96,580,663		probably null	Het
Gm4788	C	A	1: 139,731,677	E705*	probably null	Het
Gprc6a	A	T	10: 51,628,499	M83K	probably benign	Het
Hcrtr2	A	G	9: 76,259,731	L108P	probably damaging	Het
Herc2	T	A	7: 56,203,827	L3689Q	probably damaging	Het
Igf2bp1	T	C	11: 95,968,464	M407V	probably benign	Het
Irgq	A	T	7: 24,533,760	E342V	probably damaging	Het
Itih2	A	T	2: 10,105,163	I593N	probably damaging	Het
Ivd	G	T	2: 118,871,389	G101C	probably damaging	Het
Jakmip1	G	A	5: 37,091,364	G123S	probably damaging	Het
Kif14	T	A	1: 136,479,170	I580N	probably damaging	Het
Kmt2e	A	T	5: 23,464,857	Y114F	probably damaging	Het
Ly6g5b	C	A	17: 35,114,704	C99F	probably damaging	Het
Map3k20	C	T	2: 72,441,414	P629S	probably benign	Het
Mpl	A	G	4: 118,448,544		probably null	Het
Muc4	T	C	16: 32,762,488	F476L	probably damaging	Het
Mup18	T	C	4: 61,671,962	T110A	probably benign	Het
Nlrp9a	A	G	7: 26,558,178	D407G	probably benign	Het
Nmur1	G	A	1: 86,386,468	R359C	probably benign	Het
Olfr206	T	C	16: 59,345,147	T185A	probably benign	Het
Olfr488	C	T	7: 108,255,748	C130Y	possibly damaging	Het
Panx3	A	T	9: 37,661,300	M318K	probably damaging	Het
Pcnx	T	C	12: 81,953,003		probably null	Het
Pcsk5	T	C	19: 17,477,877	Y1063C	possibly damaging	Het
Rere	G	A	4: 150,468,738	R129H	probably damaging	Het
Rpgrip1	A	G	14: 52,112,176	Y7C	possibly damaging	Het
Serpina6	T	C	12: 103,646,994	N349S	possibly damaging	Het
Slc10a1	T	G	12: 80,955,976	E296A	probably damaging	Het
Slc2a9	A	T	5: 38,452,871		probably null	Het
Sptan1	T	A	2: 29,983,209	M138K	probably benign	Het
Tbl3	T	C	17: 24,705,259	T175A	probably benign	Het
Tbrg4	T	C	11: 6,620,810	T221A	possibly damaging	Het
Tenm2	T	C	11: 36,041,551	T1739A	probably damaging	Het
Tmed5	T	C	5: 108,132,321	D35G	probably benign	Het
Tnfsf15	A	T	4: 63,729,652	S250R	probably damaging	Het
Tnpo2	G	T	8: 85,055,078	V830F	probably benign	Het
Ttbk2	G	T	2: 120,740,111	S1187Y	probably damaging	Het
Ttn	G	A	2: 76,794,685	T15183M	possibly damaging	Het
Tubgcp3	T	C	8: 12,639,259		probably null	Het
Vmn1r38	T	C	6: 66,776,294	I279M	possibly damaging	Het
Vmn1r49	A	T	6: 90,072,268	Y251N	possibly damaging	Het
Vmn1r66	C	T	7: 10,274,555	V184I	probably benign	Het
Vmn2r26	T	A	6: 124,061,296	M610K	probably benign	Het
Xrn2	C	T	2: 147,042,093	P591S	probably damaging	Het

Other mutations in Grik5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Grik5	APN	7	25065393	missense	probably damaging	1.00
IGL00974:Grik5	APN	7	25013885	missense	probably damaging	1.00
IGL01941:Grik5	APN	7	25065182	missense	probably damaging	1.00
IGL02642:Grik5	APN	7	25058983	missense	possibly damaging	0.51
IGL03177:Grik5	APN	7	25015454	missense	probably damaging	1.00
IGL03402:Grik5	APN	7	25015469	missense	probably damaging	1.00
Griffin	UTSW	7	25059077	missense	possibly damaging	0.78
G1citation:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
PIT4453001:Grik5	UTSW	7	25010694	missense	probably damaging	0.99
R0077:Grik5	UTSW	7	25023380	missense	probably damaging	1.00
R0412:Grik5	UTSW	7	25013674	missense	possibly damaging	0.59
R0427:Grik5	UTSW	7	25058498	missense	probably benign	0.34
R1191:Grik5	UTSW	7	25058325	nonsense	probably null
R1830:Grik5	UTSW	7	25046301	missense	possibly damaging	0.94
R2072:Grik5	UTSW	7	25015313	missense	possibly damaging	0.92
R2369:Grik5	UTSW	7	25058537	missense	probably damaging	1.00
R3410:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3411:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3615:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R3616:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R4600:Grik5	UTSW	7	25068064	missense	probably damaging	0.99
R4658:Grik5	UTSW	7	25060727	splice site	probably benign
R4735:Grik5	UTSW	7	25058288	missense	probably damaging	1.00
R4810:Grik5	UTSW	7	25015497	missense	probably damaging	0.98
R5113:Grik5	UTSW	7	25015527	missense	probably damaging	1.00
R5120:Grik5	UTSW	7	25010640	missense	probably damaging	1.00
R5132:Grik5	UTSW	7	25065204	missense	probably benign	0.02
R5173:Grik5	UTSW	7	25062894	missense	possibly damaging	0.76
R5186:Grik5	UTSW	7	25015819	missense	probably damaging	1.00
R5239:Grik5	UTSW	7	25065470	missense	probably damaging	1.00
R5935:Grik5	UTSW	7	25059077	missense	possibly damaging	0.78
R6335:Grik5	UTSW	7	25013594	missense	probably benign
R6609:Grik5	UTSW	7	25015526	nonsense	probably null
R6760:Grik5	UTSW	7	25058939	critical splice donor site	probably null
R6820:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6821:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6822:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6824:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R7230:Grik5	UTSW	7	25023070	missense	probably damaging	1.00
R7555:Grik5	UTSW	7	25060597	missense	probably benign
R7560:Grik5	UTSW	7	25058526	missense	probably damaging	0.99
R7571:Grik5	UTSW	7	25013885	missense	possibly damaging	0.87
R8228:Grik5	UTSW	7	25010508	missense	probably damaging	1.00
R8228:Grik5	UTSW	7	25046310	missense	possibly damaging	0.93
R8681:Grik5	UTSW	7	25010472	missense	probably benign	0.06
R8879:Grik5	UTSW	7	25023064	missense	possibly damaging	0.95
R8933:Grik5	UTSW	7	25023318	missense	probably benign	0.11
R9129:Grik5	UTSW	7	25068004	splice site	probably benign
R9130:Grik5	UTSW	7	25068004	splice site	probably benign
R9154:Grik5	UTSW	7	25058978	missense	probably damaging	1.00
R9317:Grik5	UTSW	7	25046235	missense	probably damaging	0.99
R9355:Grik5	UTSW	7	25068172	missense	possibly damaging	0.82
R9406:Grik5	UTSW	7	25058544	missense	probably benign	0.00
X0017:Grik5	UTSW	7	25060588	missense	probably damaging	1.00
Z1176:Grik5	UTSW	7	25013804	missense	probably damaging	0.98
Z1177:Grik5	UTSW	7	25015825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGTGAGACAGAGCCAGCC -3'
(R):5'- AGTCCAGATACTCTGCCAGC -3'

Sequencing Primer
(F):5'- TGGGAACAAGGCTGAGCTG -3'
(R):5'- CCAGCCTTAGATCCAGGAGTCTAG -3'

Posted On

2019-06-26