Incidental Mutation 'R7173:Cln3'
ID558428
Institutional Source Beutler Lab
Gene Symbol Cln3
Ensembl Gene ENSMUSG00000030720
Gene Nameceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)
Synonymsbattenin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126571207-126585817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126579417 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 173 (T173A)
Ref Sequence ENSEMBL: ENSMUSP00000032962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032962] [ENSMUST00000084589] [ENSMUST00000098036] [ENSMUST00000116269] [ENSMUST00000125508] [ENSMUST00000128970] [ENSMUST00000147086] [ENSMUST00000150311] [ENSMUST00000150587] [ENSMUST00000150917]
Predicted Effect probably damaging
Transcript: ENSMUST00000032962
AA Change: T173A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032962
Gene: ENSMUSG00000030720
AA Change: T173A

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084589
AA Change: T173A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720
AA Change: T173A

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098036
AA Change: T149A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095644
Gene: ENSMUSG00000030720
AA Change: T149A

DomainStartEndE-ValueType
Pfam:CLN3 37 414 4.3e-191 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116269
AA Change: T173A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111973
Gene: ENSMUSG00000030720
AA Change: T173A

DomainStartEndE-ValueType
Pfam:CLN3 39 437 1.6e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125508
AA Change: T149A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117561
Gene: ENSMUSG00000030720
AA Change: T149A

DomainStartEndE-ValueType
Pfam:CLN3 37 76 1.2e-17 PFAM
Pfam:CLN3 73 151 2.8e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128970
AA Change: T173A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114901
Gene: ENSMUSG00000030720
AA Change: T173A

DomainStartEndE-ValueType
Pfam:CLN3 37 196 1.2e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147086
Predicted Effect probably benign
Transcript: ENSMUST00000150311
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150587
SMART Domains Protein: ENSMUSP00000118054
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 70 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150917
SMART Domains Protein: ENSMUSP00000138688
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 77 1.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein called battenin that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis genes, cause a number of neurodegenerative diseases collectively known as neuronal ceroid lipofuscinoses, the most common of which is juvenile neuronal ceroid-lipofuscinosis (Batten disease). Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Nullizygous mutations can result in neuronal ceroid lipofuscinosis, degeneration of the retina, cerebral cortex and cerebellum, hypertrophy of hippocampal interneuron populations, gliosis, neurological deficits, and premature death. Homozygotes for a null allele show impaired water and K+ balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Cln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Cln3 APN 7 126575254 missense probably damaging 1.00
IGL01603:Cln3 APN 7 126575354 missense probably benign 0.30
IGL02216:Cln3 APN 7 126575342 critical splice donor site probably null
IGL02440:Cln3 APN 7 126582782 missense probably benign 0.01
IGL03118:Cln3 APN 7 126575397 missense probably null 0.00
R0326:Cln3 UTSW 7 126583045 start codon destroyed probably damaging 0.96
R0610:Cln3 UTSW 7 126580189 missense probably damaging 1.00
R1256:Cln3 UTSW 7 126583036 missense probably damaging 0.98
R2136:Cln3 UTSW 7 126582799 missense probably benign 0.00
R2202:Cln3 UTSW 7 126579218 missense probably benign 0.11
R3977:Cln3 UTSW 7 126580136 splice site probably benign
R4563:Cln3 UTSW 7 126572558 missense probably damaging 0.98
R4690:Cln3 UTSW 7 126575393 missense possibly damaging 0.61
R4936:Cln3 UTSW 7 126575221 missense probably damaging 1.00
R5668:Cln3 UTSW 7 126572386 missense probably benign 0.01
R5726:Cln3 UTSW 7 126575501 missense probably null 0.00
R6385:Cln3 UTSW 7 126575035 missense probably null 1.00
R6591:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6691:Cln3 UTSW 7 126579434 missense possibly damaging 0.82
R6891:Cln3 UTSW 7 126582803 missense possibly damaging 0.88
R7214:Cln3 UTSW 7 126582770 missense probably damaging 1.00
R7426:Cln3 UTSW 7 126581740 missense probably benign 0.31
R7520:Cln3 UTSW 7 126581680 missense probably damaging 1.00
R7556:Cln3 UTSW 7 126575070 missense probably damaging 0.97
R7761:Cln3 UTSW 7 126581714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGAAAGTAGGGTGTGCTGC -3'
(R):5'- AGACCCTAGCCTGTCTGTTC -3'

Sequencing Primer
(F):5'- GCCAGCCTGGGTGAGTC -3'
(R):5'- TCAGTGACAGATCTGTTCTTAGC -3'
Posted On2019-06-26