Mutagenetix > Incidental Mutation

Incidental Mutation 'R7173:Enpp3'

558434

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R7173 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 24774047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 827 (V827G)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: V827G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: V827G

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	C	T	15: 84,949,647	V403I	possibly damaging	Het
Actn1	G	A	12: 80,177,259	R475C	possibly damaging	Het
Adam11	T	C	11: 102,771,931	L191P	possibly damaging	Het
Adam21	G	T	12: 81,559,234	Q585K	probably benign	Het
Akap3	T	C	6: 126,864,766	V116A	probably benign	Het
Alpk1	A	T	3: 127,684,375	Y74*	probably null	Het
Alx4	G	T	2: 93,642,857	G67C	possibly damaging	Het
Ankrd17	A	T	5: 90,260,117	C1414S	possibly damaging	Het
Ankrd44	T	C	1: 54,766,391	D170G	probably damaging	Het
Arpc2	T	A	1: 74,264,372	M266K	probably damaging	Het
Atp12a	A	T	14: 56,384,380	N794I	probably damaging	Het
Cabin1	A	G	10: 75,746,562	L340P	probably benign	Het
Ccer1	A	T	10: 97,693,355		probably benign	Het
Cfap73	A	T	5: 120,634,214	Y8N	probably damaging	Het
Cln3	T	C	7: 126,579,417	T173A	probably damaging	Het
Cxcl3	A	T	5: 90,786,149		probably benign	Het
Cyp2c66	G	C	19: 39,170,957	C284S	probably benign	Het
Dnajc22	T	C	15: 99,101,306	V124A	probably benign	Het
Dync1h1	C	G	12: 110,601,739	D45E	probably benign	Het
Elmod3	A	T	6: 72,577,252		probably null	Het
Esyt2	T	C	12: 116,363,534	I574T	probably benign	Het
Ext2	A	T	2: 93,813,612	I108N	probably damaging	Het
Fam186a	T	C	15: 99,945,650	I904M	unknown	Het
Fam192a	A	T	8: 94,588,858	F15L	probably damaging	Het
Fmnl2	T	C	2: 53,114,190	I638T	unknown	Het
Fndc3c1	G	C	X: 106,435,073	L724V	possibly damaging	Het
Fras1	G	T	5: 96,778,078	A3714S	probably damaging	Het
Fsd1	C	A	17: 55,996,696	R479S	possibly damaging	Het
Gaa	C	T	11: 119,278,991	L624F	probably damaging	Het
Galnt2	G	A	8: 124,305,553	V86I	probably benign	Het
Gdap1l1	T	G	2: 163,438,688	V48G	probably damaging	Het
Gm10549	A	G	18: 33,464,409	T83A	unknown	Het
Gm11437	T	G	11: 84,164,548	T81P	probably benign	Het
Gm16253	T	C	3: 96,580,663		probably null	Het
Gm4788	C	A	1: 139,731,677	E705*	probably null	Het
Gprc6a	A	T	10: 51,628,499	M83K	probably benign	Het
Grik5	T	C	7: 25,068,162	D31G	probably damaging	Het
Hcrtr2	A	G	9: 76,259,731	L108P	probably damaging	Het
Herc2	T	A	7: 56,203,827	L3689Q	probably damaging	Het
Igf2bp1	T	C	11: 95,968,464	M407V	probably benign	Het
Irgq	A	T	7: 24,533,760	E342V	probably damaging	Het
Itih2	A	T	2: 10,105,163	I593N	probably damaging	Het
Ivd	G	T	2: 118,871,389	G101C	probably damaging	Het
Jakmip1	G	A	5: 37,091,364	G123S	probably damaging	Het
Kif14	T	A	1: 136,479,170	I580N	probably damaging	Het
Kmt2e	A	T	5: 23,464,857	Y114F	probably damaging	Het
Ly6g5b	C	A	17: 35,114,704	C99F	probably damaging	Het
Map3k20	C	T	2: 72,441,414	P629S	probably benign	Het
Mpl	A	G	4: 118,448,544		probably null	Het
Muc4	T	C	16: 32,762,488	F476L	probably damaging	Het
Mup18	T	C	4: 61,671,962	T110A	probably benign	Het
Nlrp9a	A	G	7: 26,558,178	D407G	probably benign	Het
Nmur1	G	A	1: 86,386,468	R359C	probably benign	Het
Olfr206	T	C	16: 59,345,147	T185A	probably benign	Het
Olfr488	C	T	7: 108,255,748	C130Y	possibly damaging	Het
Panx3	A	T	9: 37,661,300	M318K	probably damaging	Het
Pcnx	T	C	12: 81,953,003		probably null	Het
Pcsk5	T	C	19: 17,477,877	Y1063C	possibly damaging	Het
Rere	G	A	4: 150,468,738	R129H	probably damaging	Het
Rpgrip1	A	G	14: 52,112,176	Y7C	possibly damaging	Het
Serpina6	T	C	12: 103,646,994	N349S	possibly damaging	Het
Slc10a1	T	G	12: 80,955,976	E296A	probably damaging	Het
Slc2a9	A	T	5: 38,452,871		probably null	Het
Sptan1	T	A	2: 29,983,209	M138K	probably benign	Het
Tbl3	T	C	17: 24,705,259	T175A	probably benign	Het
Tbrg4	T	C	11: 6,620,810	T221A	possibly damaging	Het
Tenm2	T	C	11: 36,041,551	T1739A	probably damaging	Het
Tmed5	T	C	5: 108,132,321	D35G	probably benign	Het
Tnfsf15	A	T	4: 63,729,652	S250R	probably damaging	Het
Tnpo2	G	T	8: 85,055,078	V830F	probably benign	Het
Ttbk2	G	T	2: 120,740,111	S1187Y	probably damaging	Het
Ttn	G	A	2: 76,794,685	T15183M	possibly damaging	Het
Tubgcp3	T	C	8: 12,639,259		probably null	Het
Vmn1r38	T	C	6: 66,776,294	I279M	possibly damaging	Het
Vmn1r49	A	T	6: 90,072,268	Y251N	possibly damaging	Het
Vmn1r66	C	T	7: 10,274,555	V184I	probably benign	Het
Vmn2r26	T	A	6: 124,061,296	M610K	probably benign	Het
Xrn2	C	T	2: 147,042,093	P591S	probably damaging	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCGTTTCTGCCAAATACTGAC -3'
(R):5'- CAGCACAGTGGGTAGGAGTTTATAG -3'

Sequencing Primer
(F):5'- AATGTCACCAGCTCTATAGGACTCTG -3'
(R):5'- TACACCACGGGGAAAATG -3'

Posted On

2019-06-26