Incidental Mutation 'R0588:Atp2a3'
List |< first << previous [record 5 of 25] next >> last >|
ID55844
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene NameATPase, Ca++ transporting, ubiquitous
SynonymsSerca3
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R0588 (G1)
Quality Score211
Status Validated
Chromosome11
Chromosomal Location72961169-72993044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72973024 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 192 (D192V)
Ref Sequence ENSEMBL: ENSMUSP00000104125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021142
AA Change: D192V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788
AA Change: D192V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108484
AA Change: D192V

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788
AA Change: D192V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108485
AA Change: D192V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788
AA Change: D192V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108486
AA Change: D192V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788
AA Change: D192V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149493
Predicted Effect probably benign
Transcript: ENSMUST00000163326
AA Change: D192V

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788
AA Change: D192V

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72982787 missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72982665 missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72981897 missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72987984 missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72977207 missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72977128 splice site probably benign
R0193:Atp2a3 UTSW 11 72972220 missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72970931 critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72982702 missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72977232 splice site probably null
R0494:Atp2a3 UTSW 11 72981905 missense probably damaging 1.00
R0674:Atp2a3 UTSW 11 72981885 missense probably damaging 1.00
R1586:Atp2a3 UTSW 11 72991744 missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72978807 critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72975414 missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72980448 missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72981797 missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72973029 missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72982680 missense probably damaging 1.00
R5083:Atp2a3 UTSW 11 72982826 missense probably null 0.49
R5174:Atp2a3 UTSW 11 72980215 missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72975397 missense probably damaging 1.00
R5304:Atp2a3 UTSW 11 72988557 missense probably damaging 0.98
R5802:Atp2a3 UTSW 11 72972882 missense probably damaging 1.00
R6107:Atp2a3 UTSW 11 72988461 critical splice acceptor site probably null
R6157:Atp2a3 UTSW 11 72980616 missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72982740 missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72978750 missense probably damaging 1.00
Z1176:Atp2a3 UTSW 11 72980622 missense possibly damaging 0.96
Z1176:Atp2a3 UTSW 11 72989540 missense probably benign
Z1177:Atp2a3 UTSW 11 72980327 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTCATCGAGATCAAGTCCACCACA -3'
(R):5'- GCTGGAGTGAGCAGAGACTGAGC -3'

Sequencing Primer
(F):5'- ACACTTCGAGTGGACCAGTC -3'
(R):5'- tgagtggggaggttggg -3'
Posted On2013-07-11