Incidental Mutation 'R0588:Sostdc1'
List |< first << previous [record 23 of 25] next >> last >|
ID55845
Institutional Source Beutler Lab
Gene Symbol Sostdc1
Ensembl Gene ENSMUSG00000036169
Gene Namesclerostin domain containing 1
Synonymsectodin, Wise, Sostl, USAG-1
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R0588 (G1)
Quality Score163
Status Validated
Chromosome12
Chromosomal Location36314139-36318452 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 36317021 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041407]
Predicted Effect probably benign
Transcript: ENSMUST00000041407
SMART Domains Protein: ENSMUSP00000040230
Gene: ENSMUSG00000036169

DomainStartEndE-ValueType
Pfam:Sclerostin 6 206 2.1e-112 PFAM
Pfam:DAN 47 168 3.2e-17 PFAM
Pfam:Cys_knot 72 185 1.2e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of tooth development, including tooth number, size and cusp pattern. Observed phenotypes may include cranial and palatal defects, neonatal death, altered trigeminal ganglion morphology, and resistance to cisplatin-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Sostdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Sostdc1 APN 12 36317122 missense probably damaging 1.00
R0671:Sostdc1 UTSW 12 36317341 missense probably damaging 0.99
R2184:Sostdc1 UTSW 12 36317296 missense probably damaging 0.97
R4320:Sostdc1 UTSW 12 36317420 missense probably benign 0.04
R4480:Sostdc1 UTSW 12 36317166 missense probably damaging 0.99
R5511:Sostdc1 UTSW 12 36317166 missense probably damaging 1.00
R5589:Sostdc1 UTSW 12 36317247 nonsense probably null
R5665:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6453:Sostdc1 UTSW 12 36314408 missense probably benign 0.39
R6752:Sostdc1 UTSW 12 36314412 missense probably benign 0.00
R7232:Sostdc1 UTSW 12 36317311 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AATGAAAGTGTCTTCCAAGCCTCCC -3'
(R):5'- AGTCCAGGTCTAGCTCAGACTGTG -3'

Sequencing Primer
(F):5'- CGCAGACTTGCATTGTGAAC -3'
(R):5'- ACACGCTTTCAAAGTTGTGG -3'
Posted On2013-07-11