Incidental Mutation 'R7174:Ceacam5'
ID558489
Institutional Source Beutler Lab
Gene Symbol Ceacam5
Ensembl Gene ENSMUSG00000008789
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 5
SynonymsPsg30, 1600029H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7174 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17713238-17761132 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 17757914 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081907]
Predicted Effect probably null
Transcript: ENSMUST00000081907
SMART Domains Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789

DomainStartEndE-ValueType
IG 40 141 4.46e-1 SMART
IG_like 160 261 2.96e1 SMART
IG_like 277 378 5.86e0 SMART
IG_like 397 496 4.07e1 SMART
IG 514 615 2.64e0 SMART
IG_like 634 735 2.81e1 SMART
IG 753 853 1.72e-2 SMART
IGc2 869 933 1.28e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Ceacam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ceacam5 APN 7 17759556 nonsense probably null
IGL00981:Ceacam5 APN 7 17745533 missense probably benign 0.08
IGL01314:Ceacam5 APN 7 17747256 nonsense probably null
IGL01329:Ceacam5 APN 7 17745609 missense probably damaging 0.98
IGL01389:Ceacam5 APN 7 17747375 missense probably damaging 0.96
IGL01418:Ceacam5 APN 7 17745599 missense probably damaging 1.00
IGL02418:Ceacam5 APN 7 17759434 missense possibly damaging 0.71
IGL02734:Ceacam5 APN 7 17750812 missense probably damaging 1.00
IGL03220:Ceacam5 APN 7 17760728 missense probably damaging 1.00
IGL03377:Ceacam5 APN 7 17715131 missense probably benign 0.15
IGL03395:Ceacam5 APN 7 17745379 splice site probably benign
IGL03054:Ceacam5 UTSW 7 17759454 missense possibly damaging 0.71
R0456:Ceacam5 UTSW 7 17760851 missense possibly damaging 0.63
R0624:Ceacam5 UTSW 7 17714963 missense probably benign 0.03
R0847:Ceacam5 UTSW 7 17757837 missense possibly damaging 0.71
R0879:Ceacam5 UTSW 7 17757702 missense probably benign 0.16
R0945:Ceacam5 UTSW 7 17747344 missense probably damaging 1.00
R1382:Ceacam5 UTSW 7 17752165 missense probably benign 0.33
R1474:Ceacam5 UTSW 7 17747234 missense probably damaging 1.00
R1526:Ceacam5 UTSW 7 17750695 missense probably damaging 1.00
R1793:Ceacam5 UTSW 7 17747395 missense probably benign 0.01
R1851:Ceacam5 UTSW 7 17714910 nonsense probably null
R1907:Ceacam5 UTSW 7 17752384 missense possibly damaging 0.85
R1913:Ceacam5 UTSW 7 17759577 nonsense probably null
R1990:Ceacam5 UTSW 7 17757880 missense probably damaging 0.99
R1999:Ceacam5 UTSW 7 17747247 missense possibly damaging 0.66
R2336:Ceacam5 UTSW 7 17747375 missense probably benign 0.28
R2355:Ceacam5 UTSW 7 17745635 missense probably damaging 1.00
R3106:Ceacam5 UTSW 7 17747323 missense probably benign 0.06
R3423:Ceacam5 UTSW 7 17757637 missense possibly damaging 0.52
R3432:Ceacam5 UTSW 7 17714976 missense probably benign 0.06
R3686:Ceacam5 UTSW 7 17760823 missense possibly damaging 0.94
R3713:Ceacam5 UTSW 7 17759338 missense possibly damaging 0.52
R3878:Ceacam5 UTSW 7 17750581 missense probably damaging 1.00
R4214:Ceacam5 UTSW 7 17752151 missense probably benign 0.00
R4335:Ceacam5 UTSW 7 17752129 missense probably benign
R4725:Ceacam5 UTSW 7 17760677 missense probably benign 0.26
R4823:Ceacam5 UTSW 7 17757744 missense possibly damaging 0.71
R4833:Ceacam5 UTSW 7 17752258 missense probably benign
R4986:Ceacam5 UTSW 7 17757833 missense possibly damaging 0.85
R5099:Ceacam5 UTSW 7 17745588 missense probably damaging 0.96
R5365:Ceacam5 UTSW 7 17759548 missense probably damaging 0.98
R5522:Ceacam5 UTSW 7 17715080 missense probably benign
R5605:Ceacam5 UTSW 7 17747236 missense probably benign 0.03
R6199:Ceacam5 UTSW 7 17714885 missense probably benign 0.00
R6222:Ceacam5 UTSW 7 17745547 missense probably benign 0.15
R6320:Ceacam5 UTSW 7 17747198 missense probably damaging 1.00
R6464:Ceacam5 UTSW 7 17747466 critical splice donor site probably null
R6521:Ceacam5 UTSW 7 17750831 critical splice donor site probably null
R6568:Ceacam5 UTSW 7 17745491 missense probably damaging 1.00
R6573:Ceacam5 UTSW 7 17713447 start codon destroyed probably null 0.70
R6814:Ceacam5 UTSW 7 17752287 nonsense probably null
R6872:Ceacam5 UTSW 7 17752287 nonsense probably null
R6930:Ceacam5 UTSW 7 17750834 splice site probably null
R7071:Ceacam5 UTSW 7 17750652 missense possibly damaging 0.49
R7121:Ceacam5 UTSW 7 17745537 missense probably benign 0.29
R7187:Ceacam5 UTSW 7 17759485 missense possibly damaging 0.85
R7355:Ceacam5 UTSW 7 17747387 missense probably damaging 1.00
R7411:Ceacam5 UTSW 7 17750753 missense probably damaging 0.99
R7462:Ceacam5 UTSW 7 17760839 missense probably damaging 1.00
R7612:Ceacam5 UTSW 7 17759416 missense possibly damaging 0.86
R7803:Ceacam5 UTSW 7 17759392 missense probably damaging 0.98
R7943:Ceacam5 UTSW 7 17745566 missense probably benign 0.26
R8342:Ceacam5 UTSW 7 17752246 missense possibly damaging 0.53
R8356:Ceacam5 UTSW 7 17745699 missense possibly damaging 0.68
R8426:Ceacam5 UTSW 7 17759341 missense possibly damaging 0.51
R8456:Ceacam5 UTSW 7 17745699 missense possibly damaging 0.68
R8534:Ceacam5 UTSW 7 17750746 missense probably benign 0.20
R8815:Ceacam5 UTSW 7 17759360 missense possibly damaging 0.85
R8871:Ceacam5 UTSW 7 17760902 missense probably benign 0.12
X0020:Ceacam5 UTSW 7 17760909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGTACAAAGGCGTGATTG -3'
(R):5'- TTTCCACCAGTGAGAGTCAAAC -3'

Sequencing Primer
(F):5'- CGAGGAGAAATCTGAGCTCATCC -3'
(R):5'- GAGTCAAACAAAAGTCTGGCTC -3'
Posted On2019-06-26