Incidental Mutation 'R7174:Olfr533'
ID558497
Institutional Source Beutler Lab
Gene Symbol Olfr533
Ensembl Gene ENSMUSG00000056883
Gene Nameolfactory receptor 533
SynonymsMOR252-3P, GA_x6K02T2PBJ9-42615403-42616365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7174 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140463370-140468128 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 140467163 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 321 (*321Q)
Ref Sequence ENSEMBL: ENSMUSP00000148260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071755] [ENSMUST00000211093] [ENSMUST00000215308] [ENSMUST00000216258] [ENSMUST00000217179]
Predicted Effect probably null
Transcript: ENSMUST00000071755
AA Change: *321Q
SMART Domains Protein: ENSMUSP00000071667
Gene: ENSMUSG00000056883
AA Change: *321Q

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 3e-6 PFAM
Pfam:7tm_1 41 289 5.6e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211093
AA Change: *321Q
Predicted Effect probably null
Transcript: ENSMUST00000215308
AA Change: *321Q
Predicted Effect probably null
Transcript: ENSMUST00000216258
AA Change: *321Q
Predicted Effect probably null
Transcript: ENSMUST00000217179
AA Change: *321Q
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Olfr533
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr533 APN 7 140466379 missense probably damaging 0.99
IGL02582:Olfr533 APN 7 140466647 missense probably benign
IGL02954:Olfr533 APN 7 140466440 nonsense probably null
R0790:Olfr533 UTSW 7 140467049 missense possibly damaging 0.79
R1754:Olfr533 UTSW 7 140466860 missense probably damaging 1.00
R1965:Olfr533 UTSW 7 140466661 missense probably benign
R2155:Olfr533 UTSW 7 140466591 missense probably benign 0.13
R4613:Olfr533 UTSW 7 140467068 missense probably damaging 1.00
R4836:Olfr533 UTSW 7 140467076 missense probably damaging 1.00
R5493:Olfr533 UTSW 7 140466807 missense probably damaging 1.00
R5694:Olfr533 UTSW 7 140466731 missense probably benign 0.28
R6101:Olfr533 UTSW 7 140466519 missense probably benign 0.31
R6156:Olfr533 UTSW 7 140466845 missense probably benign
R6519:Olfr533 UTSW 7 140466545 missense probably benign 0.01
R6672:Olfr533 UTSW 7 140466735 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466887 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466921 missense probably damaging 1.00
R7086:Olfr533 UTSW 7 140466428 missense possibly damaging 0.89
R7465:Olfr533 UTSW 7 140466798 missense probably damaging 0.99
R7486:Olfr533 UTSW 7 140466034 start gained probably benign
R7872:Olfr533 UTSW 7 140466783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGGTTCCTGGACAAAC -3'
(R):5'- ACTTGTGGCCAAAGACACAG -3'

Sequencing Primer
(F):5'- GGGTTCCTGGACAAACTCATTGC -3'
(R):5'- GCCTATACTGGGGCATAGAATCTTC -3'
Posted On2019-06-26