Incidental Mutation 'R0588:Npy6r'
List |< first << previous [record 19 of 25] next >> last >|
ID55850
Institutional Source Beutler Lab
Gene Symbol Npy6r
Ensembl Gene ENSMUSG00000038071
Gene Nameneuropeptide Y receptor Y6
Synonyms
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44270127-44277700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44275821 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 103 (V103E)
Ref Sequence ENSEMBL: ENSMUSP00000040797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042747
AA Change: V103E

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040797
Gene: ENSMUSG00000038071
AA Change: V103E

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
Pfam:7tm_1 52 318 3.5e-51 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit enhanced performance on the rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Olfr1449 A G 19: 12,934,747 Y3C probably benign Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Npy6r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Npy6r APN 18 44276444 missense probably damaging 1.00
IGL00767:Npy6r APN 18 44276318 missense probably benign 0.01
IGL01103:Npy6r APN 18 44275518 missense probably benign 0.15
IGL02085:Npy6r APN 18 44275931 missense probably damaging 1.00
IGL02653:Npy6r APN 18 44276627 makesense probably null
IGL03305:Npy6r APN 18 44275854 missense probably damaging 1.00
R1993:Npy6r UTSW 18 44276508 missense probably damaging 1.00
R2039:Npy6r UTSW 18 44276003 missense probably benign
R2567:Npy6r UTSW 18 44275821 missense possibly damaging 0.68
R4572:Npy6r UTSW 18 44275917 missense probably benign 0.03
R4584:Npy6r UTSW 18 44276195 missense probably damaging 1.00
R4611:Npy6r UTSW 18 44276401 missense probably damaging 1.00
R4741:Npy6r UTSW 18 44275724 missense probably damaging 1.00
R5145:Npy6r UTSW 18 44276619 missense probably benign 0.04
R5603:Npy6r UTSW 18 44276585 missense probably damaging 1.00
R5610:Npy6r UTSW 18 44275994 missense probably benign
R6030:Npy6r UTSW 18 44276082 missense probably benign 0.02
R6030:Npy6r UTSW 18 44276082 missense probably benign 0.02
R6083:Npy6r UTSW 18 44276492 missense probably damaging 0.99
R6364:Npy6r UTSW 18 44276511 missense possibly damaging 0.86
R7146:Npy6r UTSW 18 44275721 missense probably benign 0.30
R7178:Npy6r UTSW 18 44276484 missense probably damaging 1.00
R7180:Npy6r UTSW 18 44276156 missense probably benign
R7203:Npy6r UTSW 18 44275932 missense probably damaging 1.00
R7448:Npy6r UTSW 18 44276193 missense probably damaging 1.00
R8425:Npy6r UTSW 18 44276003 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGAAGTGCTCACAAACCAGCC -3'
(R):5'- GCAGAGAACGATCTTCAGGTAGCAG -3'

Sequencing Primer
(F):5'- ACTGTGATCCTAATCATGGGC -3'
(R):5'- GGTTCAGTTTAGAAGGCCAAATCTC -3'
Posted On2013-07-11