Incidental Mutation 'R7174:Prmt2'
ID558500
Institutional Source Beutler Lab
Gene Symbol Prmt2
Ensembl Gene ENSMUSG00000020230
Gene Nameprotein arginine N-methyltransferase 2
SynonymsHrmt1l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7174 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76207222-76237865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76225339 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 104 (D104E)
Ref Sequence ENSEMBL: ENSMUSP00000097167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020452] [ENSMUST00000099571] [ENSMUST00000099572] [ENSMUST00000128099] [ENSMUST00000137857] [ENSMUST00000217726]
Predicted Effect probably benign
Transcript: ENSMUST00000020452
AA Change: D104E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020452
Gene: ENSMUSG00000020230
AA Change: D104E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099571
AA Change: D104E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097166
Gene: ENSMUSG00000020230
AA Change: D104E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099572
AA Change: D104E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097167
Gene: ENSMUSG00000020230
AA Change: D104E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 124 253 3.1e-8 PFAM
Pfam:PRMT5 124 451 1.2e-11 PFAM
Pfam:MTS 137 223 3.3e-10 PFAM
Pfam:Methyltransf_31 147 294 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128099
AA Change: D104E

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137707
Gene: ENSMUSG00000020230
AA Change: D104E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.3e-9 PFAM
Pfam:Met_10 122 235 3.8e-8 PFAM
Pfam:TehB 122 235 6.9e-8 PFAM
Pfam:MTS 133 223 2e-11 PFAM
Pfam:Methyltransf_31 147 243 9.3e-9 PFAM
Pfam:Methyltransf_26 150 224 4.6e-10 PFAM
Pfam:Methyltransf_11 154 238 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137857
AA Change: D104E

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137725
Gene: ENSMUSG00000020230
AA Change: D104E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.5e-9 PFAM
Pfam:Met_10 129 235 4.2e-7 PFAM
Pfam:MTS 137 223 1.1e-10 PFAM
Pfam:Methyltransf_31 147 243 9.2e-9 PFAM
Pfam:Methyltransf_11 154 237 1.7e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000217726
AA Change: P103T
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a hyperplastic response to vascular injury while mutant mouse embryonic fibroblasts show an earlier S phase entry following release of serum starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Prmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Prmt2 APN 10 76222493 missense probably damaging 1.00
IGL01663:Prmt2 APN 10 76217309 splice site probably null
IGL02015:Prmt2 APN 10 76226255 nonsense probably null
IGL03094:Prmt2 APN 10 76210390 splice site probably benign
R0352:Prmt2 UTSW 10 76208503 missense possibly damaging 0.89
R0617:Prmt2 UTSW 10 76208683 intron probably benign
R0831:Prmt2 UTSW 10 76207807 unclassified probably benign
R0885:Prmt2 UTSW 10 76222565 missense probably damaging 1.00
R1882:Prmt2 UTSW 10 76222468 missense probably benign 0.00
R2022:Prmt2 UTSW 10 76225458 nonsense probably null
R2312:Prmt2 UTSW 10 76226255 nonsense probably null
R2401:Prmt2 UTSW 10 76225415 nonsense probably null
R2408:Prmt2 UTSW 10 76208467 missense probably damaging 0.98
R3753:Prmt2 UTSW 10 76225303 missense probably benign 0.01
R4707:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4785:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4937:Prmt2 UTSW 10 76221008 missense probably damaging 1.00
R5072:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5073:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5074:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5851:Prmt2 UTSW 10 76236740 missense possibly damaging 0.61
R6084:Prmt2 UTSW 10 76210444 missense probably benign 0.23
R6120:Prmt2 UTSW 10 76209446 missense possibly damaging 0.51
R6239:Prmt2 UTSW 10 76222591 nonsense probably null
R6317:Prmt2 UTSW 10 76222517 missense probably benign 0.15
R6659:Prmt2 UTSW 10 76217374 missense possibly damaging 0.85
R7421:Prmt2 UTSW 10 76221078 missense probably benign 0.00
R7485:Prmt2 UTSW 10 76221004 nonsense probably null
R8326:Prmt2 UTSW 10 76217413 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCCTACTAAGACCCAGGTGC -3'
(R):5'- ACCCAGTTATTGGTGAGATGC -3'

Sequencing Primer
(F):5'- TACTAAGACCCAGGTGCCTGTG -3'
(R):5'- ATTGGTGAGATGCCAGTCGAC -3'
Posted On2019-06-26