Incidental Mutation 'R7174:Spata31d1d'
ID558508
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7174 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59728580 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 380 (N380K)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052978
AA Change: N380K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: N380K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59726497 missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59726400 missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59731615 missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7322:Spata31d1d UTSW 13 59726976 missense probably benign
R7444:Spata31d1d UTSW 13 59727193 missense probably benign 0.33
R8206:Spata31d1d UTSW 13 59731530 missense probably benign 0.03
Z1176:Spata31d1d UTSW 13 59726167 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGTCAAGGTCTGTGATTGTCTCTC -3'
(R):5'- TTTCACAGTGCCCCAGAAAG -3'

Sequencing Primer
(F):5'- ATTGTCTCTCAGGCAAGGGCAG -3'
(R):5'- AGTGCCCCAGAAAGTCCTG -3'
Posted On2019-06-26