Incidental Mutation 'R0588:Olfr1449'
ID55851
Institutional Source Beutler Lab
Gene Symbol Olfr1449
Ensembl Gene ENSMUSG00000049498
Gene Nameolfactory receptor 1449
SynonymsGA_x6K02T2RE5P-3264213-3265157, MOR202-34
MMRRC Submission 038778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0588 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12930840-12935752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12934747 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 3 (Y3C)
Ref Sequence ENSEMBL: ENSMUSP00000148934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056005] [ENSMUST00000208624] [ENSMUST00000214079] [ENSMUST00000215325]
Predicted Effect probably benign
Transcript: ENSMUST00000056005
AA Change: Y3C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056181
Gene: ENSMUSG00000049498
AA Change: Y3C

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.5e-53 PFAM
Pfam:7tm_1 42 290 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208624
AA Change: Y3C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214079
AA Change: Y3C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215325
AA Change: Y3C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,603,061 K1299* probably null Het
Adamts2 G T 11: 50,776,664 W476C probably damaging Het
Ankrd13c T C 3: 158,005,817 F525L probably damaging Het
Arg1 T C 10: 24,920,624 S102G probably damaging Het
Atp2a3 A T 11: 72,973,024 D192V possibly damaging Het
Cabin1 T C 10: 75,745,337 E385G possibly damaging Het
Cacna1h A T 17: 25,387,564 D1020E probably damaging Het
Calcb C T 7: 114,720,126 H48Y probably benign Het
Crtc1 A G 8: 70,439,549 S4P probably damaging Het
Dcaf6 A G 1: 165,420,223 I147T possibly damaging Het
Ears2 T C 7: 122,044,291 probably benign Het
Fas T C 19: 34,327,140 V267A probably damaging Het
Fus T C 7: 127,985,574 L84P probably damaging Het
Fyb T C 15: 6,580,459 V171A probably benign Het
Gdap2 T A 3: 100,170,001 M1K probably null Het
Gprc5b T A 7: 118,983,995 Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 I273T possibly damaging Het
Map4k4 C A 1: 40,004,864 Q556K possibly damaging Het
Npy6r T A 18: 44,275,821 V103E possibly damaging Het
Shisa9 A G 16: 12,267,774 T416A probably damaging Het
Slc26a9 C A 1: 131,754,011 probably benign Het
Sostdc1 G T 12: 36,317,021 probably benign Het
St18 T A 1: 6,817,738 F510L probably damaging Het
Zdhhc7 A G 8: 120,083,367 probably benign Het
Other mutations in Olfr1449
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Olfr1449 APN 19 12935562 missense probably damaging 0.98
IGL01943:Olfr1449 APN 19 12935674 missense probably benign 0.24
IGL02966:Olfr1449 APN 19 12934800 missense probably benign 0.08
IGL02974:Olfr1449 APN 19 12935035 missense probably benign 0.02
IGL03220:Olfr1449 APN 19 12935494 missense probably damaging 1.00
PIT4531001:Olfr1449 UTSW 19 12935277 missense probably damaging 0.98
R0285:Olfr1449 UTSW 19 12935172 missense probably benign 0.00
R0573:Olfr1449 UTSW 19 12935260 missense possibly damaging 0.77
R0726:Olfr1449 UTSW 19 12935605 missense probably damaging 1.00
R1006:Olfr1449 UTSW 19 12935274 missense probably damaging 1.00
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1146:Olfr1449 UTSW 19 12934965 missense possibly damaging 0.77
R1386:Olfr1449 UTSW 19 12935139 missense probably benign 0.17
R1735:Olfr1449 UTSW 19 12934843 missense probably damaging 1.00
R1794:Olfr1449 UTSW 19 12934968 missense probably damaging 0.97
R2355:Olfr1449 UTSW 19 12935019 missense possibly damaging 0.91
R2511:Olfr1449 UTSW 19 12935173 missense possibly damaging 0.85
R4673:Olfr1449 UTSW 19 12935097 missense probably damaging 1.00
R4749:Olfr1449 UTSW 19 12935217 missense probably benign 0.02
R4765:Olfr1449 UTSW 19 12935076 missense possibly damaging 0.65
R5112:Olfr1449 UTSW 19 12934816 missense probably benign 0.01
R5958:Olfr1449 UTSW 19 12935047 missense probably damaging 1.00
R6115:Olfr1449 UTSW 19 12935584 missense possibly damaging 0.54
R6152:Olfr1449 UTSW 19 12935487 missense probably benign 0.13
R6417:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6420:Olfr1449 UTSW 19 12935220 missense probably damaging 1.00
R6695:Olfr1449 UTSW 19 12935400 missense possibly damaging 0.95
R6963:Olfr1449 UTSW 19 12935638 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGTGATACACGACTGCTCTCAGG -3'
(R):5'- AGGCGGAAGTCCAGCCATATCAAC -3'

Sequencing Primer
(F):5'- TCTGACTCTGAAATGACAGGTG -3'
(R):5'- TATCAACACGATAATGCCCAGATTC -3'
Posted On2013-07-11