Incidental Mutation 'R7174:Olfr730'
ID558510
Institutional Source Beutler Lab
Gene Symbol Olfr730
Ensembl Gene ENSMUSG00000109835
Gene Nameolfactory receptor 730
SynonymsGA_x6K02T2PMLR-5881670-5880717, MOR247-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R7174 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50183296-50188198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50186696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 175 (I175V)
Ref Sequence ENSEMBL: ENSMUSP00000060325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051453] [ENSMUST00000205837]
Predicted Effect probably benign
Transcript: ENSMUST00000051453
AA Change: I175V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060325
Gene: ENSMUSG00000109835
AA Change: I175V

DomainStartEndE-ValueType
Pfam:7tm_4 32 305 3.4e-44 PFAM
Pfam:7tm_1 42 288 1.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205837
AA Change: I174V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Olfr730
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Olfr730 APN 14 50186648 missense probably benign 0.36
IGL02976:Olfr730 APN 14 50186432 nonsense probably null
IGL03065:Olfr730 APN 14 50187008 missense probably damaging 1.00
IGL03122:Olfr730 APN 14 50187004 missense probably damaging 0.98
R0277:Olfr730 UTSW 14 50186332 missense probably null 0.06
R1081:Olfr730 UTSW 14 50187197 missense probably damaging 1.00
R1189:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R1501:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R2680:Olfr730 UTSW 14 50186847 nonsense probably null
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R3415:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3417:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3721:Olfr730 UTSW 14 50186680 missense probably damaging 1.00
R4864:Olfr730 UTSW 14 50186582 missense probably damaging 0.97
R5037:Olfr730 UTSW 14 50186288 missense probably benign 0.00
R5349:Olfr730 UTSW 14 50186773 nonsense probably null
R5738:Olfr730 UTSW 14 50186648 missense probably benign 0.09
R5779:Olfr730 UTSW 14 50186746 missense possibly damaging 0.82
R5853:Olfr730 UTSW 14 50186869 missense possibly damaging 0.88
R5918:Olfr730 UTSW 14 50186968 missense probably benign
R6166:Olfr730 UTSW 14 50186768 missense probably benign
R6196:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6218:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6220:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6561:Olfr730 UTSW 14 50186318 missense probably damaging 1.00
R6798:Olfr730 UTSW 14 50187127 missense probably benign 0.00
R6834:Olfr730 UTSW 14 50186483 missense probably benign 0.12
R7406:Olfr730 UTSW 14 50186558 missense probably damaging 0.97
R7592:Olfr730 UTSW 14 50186563 missense probably damaging 1.00
R7886:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
R7969:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
X0023:Olfr730 UTSW 14 50187201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCTTAGATGATCCTTTGG -3'
(R):5'- CCACCTGTTCACTGGTACTG -3'

Sequencing Primer
(F):5'- GCCTTAGATGATCCTTTGGAAGAATG -3'
(R):5'- ATAAGTCCCCAGGTGTGT -3'
Posted On2019-06-26