Mutagenetix > Incidental Mutation

Incidental Mutation 'R7174:Taf2'

558512

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

045266-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7174 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55048739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 524 (D524G)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041733
AA Change: D524G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: D524G

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	C	A	5: 145,044,817	A154E	probably benign	Het
Adamts1	C	A	16: 85,799,172	A419S	probably benign	Het
Arap2	C	G	5: 62,604,278	V1702L	probably benign	Het
Arpc1a	C	T	5: 145,097,277	P152S	probably benign	Het
Bbs10	T	A	10: 111,300,767	C580*	probably null	Het
Bcam	A	G	7: 19,765,451	Y216H	probably damaging	Het
C2cd3	T	C	7: 100,432,198	S1016P		Het
Card6	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG	15: 5,098,691		probably benign	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Ceacam5	T	A	7: 17,757,914		probably null	Het
Cfap57	A	G	4: 118,589,067	V666A	probably benign	Het
Cntn3	A	G	6: 102,165,344	F1021L	probably benign	Het
Cr1l	C	T	1: 195,129,189	G119D	probably benign	Het
Fgf10	A	T	13: 118,715,406	H8L	probably benign	Het
Fras1	T	A	5: 96,755,577		probably null	Het
Frem1	G	T	4: 82,922,256	T1811N	probably benign	Het
Fsd1	A	T	17: 55,991,356	Q227L	probably benign	Het
Galk2	A	G	2: 125,896,701	I138M	probably damaging	Het
Gm5152	T	C	5: 10,245,270	K56E	probably damaging	Het
Igkv8-30	A	G	6: 70,117,598	V7A	possibly damaging	Het
Katnb1	G	A	8: 95,097,441	A450T	probably benign	Het
Kif14	A	T	1: 136,521,257	E1465V	possibly damaging	Het
Klra3	A	T	6: 130,335,978		probably null	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Lepr	A	G	4: 101,750,338	N251S	probably benign	Het
Lrp2	T	C	2: 69,433,072	M4379V	probably benign	Het
Lrriq1	T	C	10: 103,224,965	N92S	probably benign	Het
Map3k13	A	G	16: 21,926,256	N855S	probably damaging	Het
Marf1	T	A	16: 14,136,953	D900V	probably damaging	Het
Nckap5l	A	T	15: 99,424,003	M1087K	probably benign	Het
Nlrp9c	T	C	7: 26,385,297	N286D	probably benign	Het
Olfr1009	C	T	2: 85,721,953	P183S	possibly damaging	Het
Olfr159	C	T	4: 43,770,691	A107T	not run	Het
Olfr497	T	A	7: 108,423,160	S196R	probably benign	Het
Olfr533	T	C	7: 140,467,163	*321Q	probably null	Het
Olfr615	A	T	7: 103,561,391	R305*	probably null	Het
Olfr730	T	C	14: 50,186,696	I175V	probably benign	Het
Pcdhga3	A	G	18: 37,675,927	T478A	probably benign	Het
Pdgfrb	T	C	18: 61,066,515	I385T	probably benign	Het
Poteg	C	T	8: 27,453,277	R192W	probably benign	Het
Prmt2	G	T	10: 76,225,339	D104E	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rlbp1	T	C	7: 79,377,342	N190S	possibly damaging	Het
Ryr2	T	C	13: 11,801,177	D641G	possibly damaging	Het
Sh3gl1	A	T	17: 56,017,846	M303K	probably benign	Het
Slc26a5	A	G	5: 21,813,894	V649A	probably damaging	Het
Slco4c1	T	C	1: 96,837,598	N376D	possibly damaging	Het
Socs3	A	T	11: 117,967,727	Y168*	probably null	Het
Spata31d1d	A	T	13: 59,728,580	N380K	possibly damaging	Het
Ssbp3	A	G	4: 107,037,646	N254S	probably benign	Het
Stard10	C	T	7: 101,346,019	S326L	probably damaging	Het
Taf7	A	T	18: 37,643,000	S171R	probably damaging	Het
Tchh	C	T	3: 93,446,171	R973C	unknown	Het
Tmem67	T	C	4: 12,077,337	R172G	possibly damaging	Het
Top2a	C	A	11: 99,024,096		probably benign	Het
Ttc8	T	A	12: 98,974,701	N323K	possibly damaging	Het
Txnl1	T	C	18: 63,671,596	N276D	probably benign	Het
Usp24	T	G	4: 106,362,681		probably null	Het
Vmn1r18	A	C	6: 57,389,624		probably null	Het
Vmn2r53	A	T	7: 12,581,701	H730Q	probably benign	Het
Wnk1	A	C	6: 119,970,978	I500M	probably damaging	Het
Zfp335	A	T	2: 164,902,503	Y451N	probably damaging	Het
Zfp683	T	A	4: 134,055,753	I176N	probably damaging	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGTTTGAGAGCCCCTCCTCTAC -3'
(R):5'- TCCAGTAGAGTGGCATTACTTTC -3'

Sequencing Primer
(F):5'- GTGCCAGGAGATGTGTAA -3'
(R):5'- GTGGCATTACTTTCAAAATACAAGC -3'

Posted On

2019-06-26