Incidental Mutation 'R0588:Fas'
ID 55852
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene Name Fas cell surface death receptor
Synonyms APO-1, Tnfrsf6, TNFR6, CD95
MMRRC Submission 038778-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R0588 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 34268066-34305172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34304540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000025691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691]
AlphaFold P25446
PDB Structure Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025691
AA Change: V267A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: V267A

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Meta Mutation Damage Score 0.7173 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,548,787 (GRCm39) K1299* probably null Het
Adamts2 G T 11: 50,667,491 (GRCm39) W476C probably damaging Het
Ankrd13c T C 3: 157,711,454 (GRCm39) F525L probably damaging Het
Arg1 T C 10: 24,796,522 (GRCm39) S102G probably damaging Het
Atp2a3 A T 11: 72,863,850 (GRCm39) D192V possibly damaging Het
Cabin1 T C 10: 75,581,171 (GRCm39) E385G possibly damaging Het
Cacna1h A T 17: 25,606,538 (GRCm39) D1020E probably damaging Het
Calcb C T 7: 114,319,361 (GRCm39) H48Y probably benign Het
Crtc1 A G 8: 70,892,199 (GRCm39) S4P probably damaging Het
Dcaf6 A G 1: 165,247,792 (GRCm39) I147T possibly damaging Het
Ears2 T C 7: 121,643,514 (GRCm39) probably benign Het
Fus T C 7: 127,584,746 (GRCm39) L84P probably damaging Het
Fyb1 T C 15: 6,609,940 (GRCm39) V171A probably benign Het
Gdap2 T A 3: 100,077,317 (GRCm39) M1K probably null Het
Gprc5b T A 7: 118,583,218 (GRCm39) Q217L probably benign Het
Lrrc69 A G 4: 14,704,001 (GRCm39) I273T possibly damaging Het
Map4k4 C A 1: 40,044,024 (GRCm39) Q556K possibly damaging Het
Npy6r T A 18: 44,408,888 (GRCm39) V103E possibly damaging Het
Or5b24 A G 19: 12,912,111 (GRCm39) Y3C probably benign Het
Shisa9 A G 16: 12,085,638 (GRCm39) T416A probably damaging Het
Slc26a9 C A 1: 131,681,749 (GRCm39) probably benign Het
Sostdc1 G T 12: 36,367,020 (GRCm39) probably benign Het
St18 T A 1: 6,887,962 (GRCm39) F510L probably damaging Het
Zdhhc7 A G 8: 120,810,106 (GRCm39) probably benign Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34,296,018 (GRCm39) missense probably damaging 1.00
IGL01677:Fas APN 19 34,296,218 (GRCm39) missense probably benign 0.09
IGL01834:Fas APN 19 34,296,003 (GRCm39) missense probably benign 0.33
IGL02130:Fas APN 19 34,292,695 (GRCm39) missense probably benign 0.01
IGL02424:Fas APN 19 34,304,434 (GRCm39) missense probably damaging 1.00
IGL02532:Fas APN 19 34,293,999 (GRCm39) missense probably damaging 0.99
IGL02569:Fas APN 19 34,297,962 (GRCm39) missense possibly damaging 0.93
amarena UTSW 19 34,296,049 (GRCm39) missense probably benign 0.01
bing UTSW 19 34,293,969 (GRCm39) missense probably damaging 1.00
cherry UTSW 19 34,304,540 (GRCm39) missense probably damaging 0.99
P0021:Fas UTSW 19 34,284,610 (GRCm39) missense probably damaging 0.98
R0525:Fas UTSW 19 34,296,727 (GRCm39) missense probably damaging 1.00
R1465:Fas UTSW 19 34,294,013 (GRCm39) missense probably damaging 1.00
R1465:Fas UTSW 19 34,294,013 (GRCm39) missense probably damaging 1.00
R2077:Fas UTSW 19 34,297,953 (GRCm39) splice site probably benign
R2283:Fas UTSW 19 34,284,649 (GRCm39) missense probably damaging 1.00
R4154:Fas UTSW 19 34,296,228 (GRCm39) missense possibly damaging 0.72
R5252:Fas UTSW 19 34,294,043 (GRCm39) missense probably damaging 0.99
R5943:Fas UTSW 19 34,297,987 (GRCm39) critical splice donor site probably null
R6474:Fas UTSW 19 34,293,969 (GRCm39) missense probably damaging 1.00
R6837:Fas UTSW 19 34,284,564 (GRCm39) missense probably damaging 0.97
R7640:Fas UTSW 19 34,284,564 (GRCm39) missense possibly damaging 0.46
R8507:Fas UTSW 19 34,304,626 (GRCm39) missense probably benign 0.00
R8837:Fas UTSW 19 34,296,049 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCACCTAGCGCAGATGTGAACC -3'
(R):5'- AGAACACACCAGGAGTTGCCAATG -3'

Sequencing Primer
(F):5'- TGAACCCGGCTTCTGTAAG -3'
(R):5'- ACTGAGGTAGTTTTCACTCCAGAC -3'
Posted On 2013-07-11