Incidental Mutation 'R7175:Olfr596'
ID558548
Institutional Source Beutler Lab
Gene Symbol Olfr596
Ensembl Gene ENSMUSG00000073953
Gene Nameolfactory receptor 596
SynonymsOlfr596-ps1, Gm15117, ENSMUSG00000073953, GA_x6K02T2PBJ9-6019769-6019943
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7175 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103305648-103312782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103309847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 42 (V42A)
Ref Sequence ENSEMBL: ENSMUSP00000149187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104880] [ENSMUST00000214577]
Predicted Effect probably benign
Transcript: ENSMUST00000104880
AA Change: V42A

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100475
Gene: ENSMUSG00000073953
AA Change: V42A

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 210 5.1e-11 PFAM
Pfam:7tm_1 43 293 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214577
AA Change: V42A

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Olfr596
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Olfr596 APN 7 103309807 missense probably benign 0.03
IGL01917:Olfr596 APN 7 103310357 nonsense probably null
G1patch:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R0601:Olfr596 UTSW 7 103310164 missense probably damaging 1.00
R0908:Olfr596 UTSW 7 103310573 missense possibly damaging 0.56
R1762:Olfr596 UTSW 7 103310221 missense probably damaging 1.00
R1772:Olfr596 UTSW 7 103310242 missense possibly damaging 0.94
R1806:Olfr596 UTSW 7 103310225 missense probably damaging 1.00
R2035:Olfr596 UTSW 7 103310256 missense probably damaging 1.00
R2365:Olfr596 UTSW 7 103310173 missense probably benign 0.00
R3827:Olfr596 UTSW 7 103309802 missense probably benign 0.12
R4241:Olfr596 UTSW 7 103310661 makesense probably null
R4619:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R4620:Olfr596 UTSW 7 103309958 missense probably benign 0.04
R6279:Olfr596 UTSW 7 103310429 missense probably benign
R6300:Olfr596 UTSW 7 103310429 missense probably benign
R6505:Olfr596 UTSW 7 103309793 missense probably benign 0.00
R6725:Olfr596 UTSW 7 103310354 missense probably damaging 1.00
R7708:Olfr596 UTSW 7 103310561 missense probably damaging 1.00
R8855:Olfr596 UTSW 7 103309961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATACCAGGGATTCATCTAC -3'
(R):5'- GAGGCAGCCTTCAAAGCTTATC -3'

Sequencing Primer
(F):5'- ACCAGGGATTCATCTACAACTTTC -3'
(R):5'- AGCTTATCTCCCTAAGGTTGAACCAG -3'
Posted On2019-06-26