Incidental Mutation 'R7175:Dhcr7'
ID558550
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name7-dehydrocholesterol reductase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7175 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143823145-143848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143845490 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 199 (T199I)
Ref Sequence ENSEMBL: ENSMUSP00000118957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000141916] [ENSMUST00000143338] [ENSMUST00000144034] [ENSMUST00000145471] [ENSMUST00000207143]
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: T290I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: T290I

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: T290I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: T290I

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: T290I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: T290I

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144034
AA Change: T199I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454
AA Change: T199I

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Predicted Effect probably damaging
Transcript: ENSMUST00000207143
AA Change: T293I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143847068 missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143841319 missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143843311 missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143845499 missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143843128 missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143847366 missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143840497 missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143837770 missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143840463 missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143841227 missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143841368 missense probably damaging 1.00
R1473:Dhcr7 UTSW 7 143847068 missense probably damaging 0.99
R1769:Dhcr7 UTSW 7 143847513 missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143847458 missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143847430 missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143837892 missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143841173 missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143843227 missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143837917 missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143840500 missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143837791 missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143841323 missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143837839 missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143847423 missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143836731 critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143843311 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGTGGGAACTATGGCTG -3'
(R):5'- TGTGTATCTGCTCAAGGACAG -3'

Sequencing Primer
(F):5'- TCCTGCTGATGACAGTGGC -3'
(R):5'- TATCTGCTCAAGGACAGCCTGAAG -3'
Posted On2019-06-26