Incidental Mutation 'R7175:Zzef1'
ID 558563
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Name zinc finger, ZZ-type with EF hand domain 1
Synonyms C130099L13Rik, 8430405D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7175 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72796226-72927120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72851901 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 769 (I769T)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069395
AA Change: I769T

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: I769T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172220
AA Change: I769T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: I769T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207107
AA Change: I769T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
R8874:Zzef1 UTSW 11 72863989 missense probably benign 0.00
R8885:Zzef1 UTSW 11 72796576 missense probably benign 0.00
R8972:Zzef1 UTSW 11 72900673 missense probably damaging 1.00
R8979:Zzef1 UTSW 11 72875177 missense probably benign 0.00
R9053:Zzef1 UTSW 11 72922476 missense probably benign
R9108:Zzef1 UTSW 11 72899778 missense probably benign 0.11
R9121:Zzef1 UTSW 11 72866120 nonsense probably null
R9370:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R9408:Zzef1 UTSW 11 72864827 missense possibly damaging 0.86
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72889182 missense probably benign
Z1187:Zzef1 UTSW 11 72889182 missense probably benign
Z1188:Zzef1 UTSW 11 72889182 missense probably benign
Z1189:Zzef1 UTSW 11 72889182 missense probably benign
Z1190:Zzef1 UTSW 11 72889182 missense probably benign
Z1191:Zzef1 UTSW 11 72889182 missense probably benign
Z1192:Zzef1 UTSW 11 72889182 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGGGTCATCTTACTTCTTAACC -3'
(R):5'- CCTGTTTATCCTATCAGCTGTGAG -3'

Sequencing Primer
(F):5'- GGGTCATCTTACTTCTTAACCATAGC -3'
(R):5'- GGAAATGGTTGAGAAATGCTTCC -3'
Posted On 2019-06-26