Incidental Mutation 'R7175:Olfr403'
ID558564
Institutional Source Beutler Lab
Gene Symbol Olfr403
Ensembl Gene ENSMUSG00000070378
Gene Nameolfactory receptor 403
SynonymsMOR125-5_p, IA7, GA_x6K02T2P1NL-4348188-4349129
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7175 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74186249-74198612 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 74196178 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 225 (L225*)
Ref Sequence ENSEMBL: ENSMUSP00000145741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076675] [ENSMUST00000206114]
AlphaFold Q7TRX2
Predicted Effect probably null
Transcript: ENSMUST00000076675
AA Change: L225*
SMART Domains Protein: ENSMUSP00000075971
Gene: ENSMUSG00000070378
AA Change: L225*

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.3e-59 PFAM
Pfam:7tm_1 41 238 7.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000206114
AA Change: L225*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Olfr403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Olfr403 APN 11 74195761 missense probably damaging 1.00
IGL01716:Olfr403 APN 11 74196381 missense probably benign 0.01
R0598:Olfr403 UTSW 11 74195832 missense possibly damaging 0.90
R1168:Olfr403 UTSW 11 74196421 missense probably benign
R1440:Olfr403 UTSW 11 74195679 missense probably damaging 1.00
R1657:Olfr403 UTSW 11 74195896 missense probably damaging 0.98
R1834:Olfr403 UTSW 11 74195653 missense probably benign 0.00
R1990:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R1991:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R2206:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R2207:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R3103:Olfr403 UTSW 11 74196075 missense probably benign 0.39
R4662:Olfr403 UTSW 11 74195716 missense probably damaging 1.00
R4844:Olfr403 UTSW 11 74196076 missense probably damaging 0.98
R5336:Olfr403 UTSW 11 74196033 missense probably damaging 1.00
R5918:Olfr403 UTSW 11 74196118 missense probably damaging 0.96
R6858:Olfr403 UTSW 11 74196099 missense probably benign 0.01
R7362:Olfr403 UTSW 11 74195586 missense probably benign 0.01
R7670:Olfr403 UTSW 11 74196207 missense probably damaging 1.00
R8677:Olfr403 UTSW 11 74195589 missense probably benign 0.00
R8957:Olfr403 UTSW 11 74195946 missense probably damaging 1.00
R9029:Olfr403 UTSW 11 74195737 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCTTCTGTGGCAATAAGGATG -3'
(R):5'- TTCAGAGCAGCCTTCATGTCC -3'

Sequencing Primer
(F):5'- AGGATGTGGCCAACTTCTAC -3'
(R):5'- TTCCTCAGGCTGTAGATGAAAG -3'
Posted On2019-06-26