Incidental Mutation 'R7175:Gm11639'
ID558566
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7175 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104947411 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 3625 (V3625A)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000212287
AA Change: V3625A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGTAGGTTTCTCAAGTCAAGAC -3'
(R):5'- CACATTTATTACTGATAGGTGCCAC -3'

Sequencing Primer
(F):5'- GGTTTCTCAAGTCAAGACTCAAAG -3'
(R):5'- CACATGCATACAGGCCTAGGG -3'
Posted On2019-06-26