Incidental Mutation 'R7175:Fam91a1'
ID558572
Institutional Source Beutler Lab
Gene Symbol Fam91a1
Ensembl Gene ENSMUSG00000037119
Gene Namefamily with sequence similarity 91, member A1
SynonymsD15Ertd621e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7175 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58415468-58457740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58430678 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 289 (Y289F)
Ref Sequence ENSEMBL: ENSMUSP00000036524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037270]
Predicted Effect probably benign
Transcript: ENSMUST00000037270
AA Change: Y289F

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036524
Gene: ENSMUSG00000037119
AA Change: Y289F

DomainStartEndE-ValueType
Pfam:FAM91_N 8 312 2.8e-149 PFAM
Pfam:FAM91_C 374 821 3.8e-182 PFAM
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Fam91a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fam91a1 APN 15 58430735 missense probably damaging 0.99
IGL00590:Fam91a1 APN 15 58415716 missense possibly damaging 0.66
IGL01301:Fam91a1 APN 15 58442871 missense probably damaging 0.99
IGL01372:Fam91a1 APN 15 58430062 missense probably damaging 1.00
IGL01979:Fam91a1 APN 15 58432584 missense probably damaging 1.00
IGL02085:Fam91a1 APN 15 58441656 missense possibly damaging 0.95
IGL02553:Fam91a1 APN 15 58432982 critical splice donor site probably null
IGL02605:Fam91a1 APN 15 58431196 splice site probably benign
IGL02882:Fam91a1 APN 15 58453061 splice site probably benign
IGL02894:Fam91a1 APN 15 58443231 missense probably benign 0.09
ANU18:Fam91a1 UTSW 15 58442871 missense probably damaging 0.99
H8562:Fam91a1 UTSW 15 58427121 splice site probably null
R0395:Fam91a1 UTSW 15 58454792 missense probably benign
R1165:Fam91a1 UTSW 15 58430669 missense possibly damaging 0.90
R1699:Fam91a1 UTSW 15 58432948 missense probably benign 0.04
R1749:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R1997:Fam91a1 UTSW 15 58424195 critical splice acceptor site probably null
R2042:Fam91a1 UTSW 15 58426594 missense probably benign 0.02
R2188:Fam91a1 UTSW 15 58430663 missense probably damaging 0.98
R2518:Fam91a1 UTSW 15 58450600 missense possibly damaging 0.92
R3124:Fam91a1 UTSW 15 58421889 missense probably benign 0.34
R3916:Fam91a1 UTSW 15 58430734 missense probably damaging 1.00
R4810:Fam91a1 UTSW 15 58434740 missense probably damaging 1.00
R4959:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R4973:Fam91a1 UTSW 15 58431210 missense probably benign 0.16
R5288:Fam91a1 UTSW 15 58448394 missense probably benign
R5385:Fam91a1 UTSW 15 58448394 missense probably benign
R5386:Fam91a1 UTSW 15 58448394 missense probably benign
R5941:Fam91a1 UTSW 15 58431317 missense probably benign 0.01
R6415:Fam91a1 UTSW 15 58442917 missense probably damaging 1.00
R6869:Fam91a1 UTSW 15 58431268 missense probably benign 0.00
R7872:Fam91a1 UTSW 15 58448360 missense probably benign 0.01
X0024:Fam91a1 UTSW 15 58430189 missense probably damaging 0.98
Z1177:Fam91a1 UTSW 15 58432548 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACTCCAGCCTCCTTAGTAGAGG -3'
(R):5'- GGATTCACCTCAATTGGCAGAG -3'

Sequencing Primer
(F):5'- CAGCCTCCTTAGTAGAGGATCTAG -3'
(R):5'- GGAAACTGTCATAAAGGACA -3'
Posted On2019-06-26