Incidental Mutation 'R7175:Ccs'
ID558583
Institutional Source Beutler Lab
Gene Symbol Ccs
Ensembl Gene ENSMUSG00000034108
Gene Namecopper chaperone for superoxide dismutase
SynonymsCCS, Ccsd
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R7175 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4825366-4839322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4833362 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 136 (D136V)
Ref Sequence ENSEMBL: ENSMUSP00000035486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037246]
Predicted Effect probably damaging
Transcript: ENSMUST00000037246
AA Change: D136V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035486
Gene: ENSMUSG00000034108
AA Change: D136V

DomainStartEndE-ValueType
Pfam:HMA 15 72 2.4e-12 PFAM
Pfam:Sod_Cu 93 230 6.7e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Copper chaperone for superoxide dismutase specifically delivers Cu to copper/zinc superoxide dismutase and may activate copper/zinc superoxide dismutase through direct insertion of the Cu cofactor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased sensitivity to paraquat and reduced female fertility. Ovaries of mutant female animals have reduced numbers of mature ovarian follicles and corpora lutea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Tle4 A T 19: 14,451,707 V717E probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Ccs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Ccs APN 19 4825608 missense possibly damaging 0.94
IGL01543:Ccs APN 19 4834241 missense possibly damaging 0.95
R0128:Ccs UTSW 19 4825626 missense probably damaging 1.00
R0928:Ccs UTSW 19 4825960 missense probably damaging 1.00
R4300:Ccs UTSW 19 4834257 missense probably benign 0.02
R4655:Ccs UTSW 19 4839204 missense probably benign
R5391:Ccs UTSW 19 4833482 missense probably benign
R5795:Ccs UTSW 19 4833339 critical splice donor site probably null
R6054:Ccs UTSW 19 4825865 missense probably benign 0.43
R7361:Ccs UTSW 19 4833350 missense probably benign
R7681:Ccs UTSW 19 4832830 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCGAGGAGTAAACAACC -3'
(R):5'- TGCCTTGCAGAGAATCTGGG -3'

Sequencing Primer
(F):5'- AGGAGTCACCCTGTATCTCAGATG -3'
(R):5'- GAGCAGCAGTGGCCATTCTG -3'
Posted On2019-06-26