Incidental Mutation 'R7175:Tle4'
ID558584
Institutional Source Beutler Lab
Gene Symbol Tle4
Ensembl Gene ENSMUSG00000024642
Gene Nametransducin-like enhancer of split 4
SynonymsBce1, ESTM14, 5730411M05Rik, Grg4, ESTM13
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7175 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location14448072-14598051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14451707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 717 (V717E)
Ref Sequence ENSEMBL: ENSMUSP00000057527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052011] [ENSMUST00000167776]
Predicted Effect probably damaging
Transcript: ENSMUST00000052011
AA Change: V717E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057527
Gene: ENSMUSG00000024642
AA Change: V717E

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 9.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167776
AA Change: V717E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126249
Gene: ENSMUSG00000024642
AA Change: V717E

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 5.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 199 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are runted and die around 4 weeks of age with leukocytopenia, B cell lymphopenia, reduced bone mineralization and reduced hematopoietic stem cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,251,789 probably null Het
4932415D10Rik T A 10: 82,286,749 S3476C probably damaging Het
Abcb5 G A 12: 118,867,876 T1247I probably benign Het
Afdn T C 17: 13,888,607 L1479P probably damaging Het
Alox12e T C 11: 70,319,708 R363G probably damaging Het
Ank2 A T 3: 126,946,941 S1765T unknown Het
Anks6 T C 4: 47,046,268 probably null Het
Apob A C 12: 8,007,034 I1839L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Ccs T A 19: 4,833,362 D136V probably damaging Het
Cd200 T C 16: 45,400,215 probably null Het
Cirbp T C 10: 80,170,463 S130P probably benign Het
Cpb1 A G 3: 20,263,763 I199T probably benign Het
Csn3 C T 5: 87,929,727 R31C probably damaging Het
Dcaf1 A T 9: 106,858,576 I908F probably benign Het
Dhcr7 C T 7: 143,845,490 T199I probably damaging Het
Dnah9 T A 11: 66,133,637 Q277L probably benign Het
Echdc2 C A 4: 108,174,169 P237T probably damaging Het
Eif4g3 A G 4: 138,126,215 N364S probably damaging Het
Eml6 T A 11: 29,784,231 I1170L probably benign Het
Epha3 C T 16: 63,583,500 R746Q probably damaging Het
Exosc5 G A 7: 25,664,369 C102Y probably damaging Het
Fam105a A C 15: 27,658,288 D165E probably damaging Het
Fam91a1 A T 15: 58,430,678 Y289F probably benign Het
Fbxo38 A C 18: 62,515,473 F665V probably benign Het
Fcrl5 T C 3: 87,446,338 V330A probably benign Het
Fer T A 17: 63,924,095 D280E probably benign Het
Gm11639 T C 11: 104,947,411 V3625A unknown Het
Gpr158 A G 2: 21,368,302 H16R probably benign Het
Gzmg C T 14: 56,159,522 M1I probably null Het
Hectd4 C T 5: 121,273,629 A456V possibly damaging Het
Hk2 T A 6: 82,734,849 Q613L probably benign Het
Itsn1 T C 16: 91,868,050 F1121L unknown Het
Lztr1 G T 16: 17,523,031 C557F possibly damaging Het
Mdn1 A G 4: 32,694,634 Y1119C probably damaging Het
Nfkb1 A T 3: 135,613,990 L248Q probably damaging Het
Olfr130 T A 17: 38,067,479 S103T probably damaging Het
Olfr403 T A 11: 74,196,178 L225* probably null Het
Olfr404-ps1 T C 11: 74,239,977 F138L probably benign Het
Olfr596 T C 7: 103,309,847 V42A probably benign Het
Pate1 T G 9: 35,685,112 D119A probably damaging Het
Pcdhgc4 T C 18: 37,816,371 V280A possibly damaging Het
Pik3ap1 T C 19: 41,287,490 D717G probably damaging Het
Prdm13 A T 4: 21,679,473 L339Q unknown Het
Rasgrf1 T A 9: 89,980,749 N519K probably benign Het
Rergl A G 6: 139,496,535 V39A probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sema4b T A 7: 80,198,654 M1K probably null Het
Slc20a1 T G 2: 129,210,742 L648R probably damaging Het
Speg A G 1: 75,422,490 T2194A probably benign Het
Spns1 T C 7: 126,373,789 D215G probably damaging Het
Trim50 T A 5: 135,353,297 M1K probably null Het
Trpa1 A G 1: 14,893,207 V597A possibly damaging Het
Usp13 C T 3: 32,917,608 Q746* probably null Het
Vmn1r35 A T 6: 66,678,922 W255R probably benign Het
Vps35 A T 8: 85,263,560 probably null Het
Vps54 T C 11: 21,315,028 probably null Het
Zfp318 T A 17: 46,386,848 L210Q probably damaging Het
Zfp319 C A 8: 95,328,782 K264N probably damaging Het
Zfp62 C T 11: 49,216,753 S557L probably damaging Het
Zgrf1 T C 3: 127,563,590 S822P probably damaging Het
Zxdc A G 6: 90,369,663 D2G possibly damaging Het
Zzef1 T C 11: 72,851,901 I769T possibly damaging Het
Other mutations in Tle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tle4 APN 19 14468261 missense probably benign 0.00
IGL01449:Tle4 APN 19 14465340 missense probably benign 0.00
IGL01618:Tle4 APN 19 14544814 missense probably benign 0.07
IGL01636:Tle4 APN 19 14452533 missense probably damaging 0.97
IGL01750:Tle4 APN 19 14449789 missense probably damaging 1.00
IGL02376:Tle4 APN 19 14594404 missense probably damaging 1.00
R0006:Tle4 UTSW 19 14466714 splice site probably benign
R1068:Tle4 UTSW 19 14452179 missense probably damaging 1.00
R1174:Tle4 UTSW 19 14468262 missense probably benign
R1594:Tle4 UTSW 19 14453606 nonsense probably null
R1671:Tle4 UTSW 19 14453739 missense probably damaging 1.00
R1891:Tle4 UTSW 19 14544786 critical splice donor site probably null
R1951:Tle4 UTSW 19 14516357 critical splice donor site probably null
R2068:Tle4 UTSW 19 14449749 nonsense probably null
R3858:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3859:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3946:Tle4 UTSW 19 14597388 missense probably damaging 0.98
R4357:Tle4 UTSW 19 14468261 missense probably benign 0.00
R4395:Tle4 UTSW 19 14517938 missense probably benign 0.20
R4491:Tle4 UTSW 19 14454865 missense probably damaging 1.00
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R5336:Tle4 UTSW 19 14454739 critical splice donor site probably null
R5516:Tle4 UTSW 19 14454889 missense probably damaging 0.99
R5611:Tle4 UTSW 19 14449795 missense probably damaging 1.00
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6113:Tle4 UTSW 19 14595588 critical splice donor site probably null
R6513:Tle4 UTSW 19 14451692 missense probably damaging 0.99
R6995:Tle4 UTSW 19 14564453 critical splice acceptor site probably null
R7310:Tle4 UTSW 19 14517791 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTCAAAGCACTTAAGCAGGGG -3'
(R):5'- CCATGCATGCTTTCCTAACAAGC -3'

Sequencing Primer
(F):5'- CTTAAGCAGGGGCACTACTCATAG -3'
(R):5'- ACTTTATTCCTTACCACAACAATCAG -3'
Posted On2019-06-26