Incidental Mutation 'R7176:Gm8251'
ID558587
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7176 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44060346 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 531 (S531T)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: S531T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: S531T

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Aqp3 T A 4: 41,095,202 N60Y probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kbtbd7 A T 14: 79,427,754 E342V possibly damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Obp2b G T 2: 25,737,748 V59L possibly damaging Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Pik3c2a T C 7: 116,388,096 D530G possibly damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slamf6 A C 1: 171,934,291 N93T probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Tbl3 G A 17: 24,700,758 T774I probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAAAACCAAGCCTTGTTCATC -3'
(R):5'- TTTGAAGACAAAGAGCTCGCC -3'

Sequencing Primer
(F):5'- ACCAAGCCTTGTTCATCTTTAAG -3'
(R):5'- GACAAAGAGCTCGCCTATTTTAC -3'
Posted On2019-06-26