Incidental Mutation 'R7176:Slamf6'
ID 558592
Institutional Source Beutler Lab
Gene Symbol Slamf6
Ensembl Gene ENSMUSG00000015314
Gene Name SLAM family member 6
Synonyms Ly108, SF2000, KAL1, KAL1b, NTB-A
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_030710.2; MGI:1353620

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 171917515-171953170 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 171934291 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 93 (N93T)
Ref Sequence ENSEMBL: ENSMUSP00000141448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]
AlphaFold Q9ET39
Predicted Effect probably benign
Transcript: ENSMUST00000171330
AA Change: N93T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314
AA Change: N93T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 7e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194182
SMART Domains Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194561
AA Change: N93T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314
AA Change: N93T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
IG 39 142 1.49e-2 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 5e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195656
AA Change: N93T

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314
AA Change: N93T

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
IG 39 142 5.9e-5 SMART
low complexity region 145 161 N/A INTRINSIC
Blast:IG_like 162 226 8e-16 BLAST
transmembrane domain 240 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3581614
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Aqp3 T A 4: 41,095,202 N60Y probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gm8251 A T 1: 44,060,346 S531T probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kbtbd7 A T 14: 79,427,754 E342V possibly damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Obp2b G T 2: 25,737,748 V59L possibly damaging Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Pik3c2a T C 7: 116,388,096 D530G possibly damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Tbl3 G A 17: 24,700,758 T774I probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Slamf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slamf6 APN 1 171917780 missense probably null 0.27
IGL01011:Slamf6 APN 1 171938099 missense probably benign 0.19
P0016:Slamf6 UTSW 1 171936501 missense probably damaging 0.97
R1565:Slamf6 UTSW 1 171934408 missense possibly damaging 0.53
R1763:Slamf6 UTSW 1 171942587 intron probably benign
R1774:Slamf6 UTSW 1 171942587 intron probably benign
R1993:Slamf6 UTSW 1 171934209 missense possibly damaging 0.74
R2155:Slamf6 UTSW 1 171938008 missense probably damaging 0.99
R2328:Slamf6 UTSW 1 171934251 missense probably benign 0.00
R4693:Slamf6 UTSW 1 171934113 nonsense probably null
R5062:Slamf6 UTSW 1 171936533 missense possibly damaging 0.93
R5172:Slamf6 UTSW 1 171936580 missense probably benign 0.01
R5249:Slamf6 UTSW 1 171936682 missense probably damaging 1.00
R5328:Slamf6 UTSW 1 171938095 missense probably benign 0.04
R5771:Slamf6 UTSW 1 171917774 missense probably damaging 0.98
R6339:Slamf6 UTSW 1 171948048 missense probably null 1.00
R6960:Slamf6 UTSW 1 171917753 missense probably damaging 0.98
R7400:Slamf6 UTSW 1 171919793 missense unknown
R7535:Slamf6 UTSW 1 171919758 missense unknown
R7629:Slamf6 UTSW 1 171936624 missense probably damaging 0.97
R8202:Slamf6 UTSW 1 171934219 missense probably benign 0.01
R8934:Slamf6 UTSW 1 171917771 missense possibly damaging 0.76
R9225:Slamf6 UTSW 1 171936703 missense probably benign 0.25
R9338:Slamf6 UTSW 1 171919590 intron probably benign
RF025:Slamf6 UTSW 1 171941582 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTCACAGAGCAGCTCAG -3'
(R):5'- TACTGTGCACTCTCGTAGGC -3'

Sequencing Primer
(F):5'- GACCCCCAGCTAATGAATGG -3'
(R):5'- TGTCTGCCATGGTAAGGT -3'
Posted On 2019-06-26