Incidental Mutation 'R7176:Obp2b'
ID 558595
Institutional Source Beutler Lab
Gene Symbol Obp2b
Ensembl Gene ENSMUSG00000079539
Gene Name odorant binding protein 2B
Synonyms Lcn14, OTTMUSG00000012631
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25737009-25740097 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25737748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 59 (V59L)
Ref Sequence ENSEMBL: ENSMUSP00000109830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114192]
AlphaFold A2BHR0
Predicted Effect possibly damaging
Transcript: ENSMUST00000114192
AA Change: V59L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109830
Gene: ENSMUSG00000079539
AA Change: V59L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Lipocalin 31 169 5.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Aqp3 T A 4: 41,095,202 N60Y probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gm8251 A T 1: 44,060,346 S531T probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kbtbd7 A T 14: 79,427,754 E342V possibly damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Pik3c2a T C 7: 116,388,096 D530G possibly damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slamf6 A C 1: 171,934,291 N93T probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Tbl3 G A 17: 24,700,758 T774I probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Obp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Obp2b APN 2 25738581 missense probably damaging 1.00
IGL01293:Obp2b APN 2 25737707 missense probably benign 0.00
IGL01731:Obp2b APN 2 25739281 missense possibly damaging 0.74
IGL01751:Obp2b APN 2 25737748 missense possibly damaging 0.89
IGL02631:Obp2b APN 2 25739243 missense probably damaging 0.96
R0035:Obp2b UTSW 2 25738633 missense probably damaging 1.00
R0035:Obp2b UTSW 2 25738633 missense probably damaging 1.00
R1753:Obp2b UTSW 2 25738640 critical splice donor site probably null
R1955:Obp2b UTSW 2 25738551 missense probably benign 0.12
R4956:Obp2b UTSW 2 25737075 missense probably damaging 0.96
R5253:Obp2b UTSW 2 25737143 missense probably benign 0.08
R6434:Obp2b UTSW 2 25738587 missense probably damaging 1.00
Z1177:Obp2b UTSW 2 25737683 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTCAGAGCAGCACTGTAGGC -3'
(R):5'- GGCAACTCGGAAGATTTATATCAAG -3'

Sequencing Primer
(F):5'- CAGCACTGTAGGCTCTGGAATATC -3'
(R):5'- CGGAAGATTTATATCAAGACCATGCC -3'
Posted On 2019-06-26