Incidental Mutation 'R0589:Olfr1220'
ID55860
Institutional Source Beutler Lab
Gene Symbol Olfr1220
Ensembl Gene ENSMUSG00000101480
Gene Nameolfactory receptor 1220
SynonymsMOR233-5, GA_x6K02T2Q125-50579531-50578596
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0589 (G1)
Quality Score199
Status Validated
Chromosome2
Chromosomal Location89094188-89106835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89097262 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 222 (F222L)
Ref Sequence ENSEMBL: ENSMUSP00000150812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099789] [ENSMUST00000099806] [ENSMUST00000213288]
Predicted Effect probably benign
Transcript: ENSMUST00000099789
AA Change: F222L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097377
Gene: ENSMUSG00000101480
AA Change: F222L

DomainStartEndE-ValueType
Pfam:7tm_4 41 315 4.2e-48 PFAM
Pfam:7tm_1 51 298 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099796
AA Change: F222L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097384
Gene: ENSMUSG00000075103
AA Change: F222L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.2e-48 PFAM
Pfam:7tm_1 39 303 7.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099806
AA Change: F222L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000097394
Gene: ENSMUSG00000101480
AA Change: F222L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7tm_1 39 286 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213288
AA Change: F222L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Olfr1220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr1220 APN 2 89097544 missense probably damaging 1.00
IGL02861:Olfr1220 APN 2 89097457 missense probably benign 0.38
IGL02990:Olfr1220 APN 2 89097129 missense possibly damaging 0.94
PIT4403001:Olfr1220 UTSW 2 89097076 missense probably benign 0.00
R1518:Olfr1220 UTSW 2 89097600 missense probably benign 0.00
R1573:Olfr1220 UTSW 2 89097720 missense probably damaging 1.00
R1800:Olfr1220 UTSW 2 89097706 missense probably benign 0.00
R1908:Olfr1220 UTSW 2 89097544 missense probably damaging 1.00
R3409:Olfr1220 UTSW 2 89097324 missense possibly damaging 0.74
R4678:Olfr1220 UTSW 2 89097516 missense probably benign 0.00
R5856:Olfr1220 UTSW 2 89097910 missense probably benign
R5888:Olfr1220 UTSW 2 89097925 start codon destroyed probably damaging 1.00
R6961:Olfr1220 UTSW 2 89097805 missense probably benign
R7197:Olfr1220 UTSW 2 89097282 missense probably benign 0.03
R7455:Olfr1220 UTSW 2 89097090 missense probably damaging 1.00
R7894:Olfr1220 UTSW 2 89097588 missense possibly damaging 0.90
R7977:Olfr1220 UTSW 2 89097588 missense possibly damaging 0.90
R8008:Olfr1220 UTSW 2 89097715 missense probably benign 0.35
X0019:Olfr1220 UTSW 2 89097896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACTGCTCTGACCCATTGACC -3'
(R):5'- TTTGCAGCTACCGTTCTGTGGACC -3'

Sequencing Primer
(F):5'- tctgacccattgaccaatctc -3'
(R):5'- ACCGTTCTGTGGACCCAATG -3'
Posted On2013-07-11