Mutagenetix > Incidental Mutation

Incidental Mutation 'R7176:Abtb2'

558600

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7176 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103709375 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 695 (D695G)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: D695G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: D695G

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	G	T	17: 46,324,277	H267N	probably benign	Het
Adam21	C	T	12: 81,560,248	D247N	possibly damaging	Het
Adnp	T	C	2: 168,182,658	N906D	probably benign	Het
Ankrd17	A	T	5: 90,268,735	H1079Q	probably damaging	Het
Aqp3	T	A	4: 41,095,202	N60Y	probably damaging	Het
Art4	T	G	6: 136,857,168	T26P	probably benign	Het
Arvcf	T	C	16: 18,399,727	L553P	probably damaging	Het
Asxl1	T	A	2: 153,401,988	I1487N	probably damaging	Het
Capn3	A	T	2: 120,504,492	Y820F	possibly damaging	Het
Catip	A	G	1: 74,362,782	T39A	probably damaging	Het
Ccdc18	T	A	5: 108,168,106	C481S	probably benign	Het
Ccnf	A	G	17: 24,249,402	I7T	possibly damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdkl4	A	T	17: 80,543,792	Y160*	probably null	Het
Celsr3	C	T	9: 108,845,762	P2783S	probably benign	Het
Cisd3	A	T	11: 97,686,133	D11V	probably benign	Het
Daxx	A	T	17: 33,913,318	H512L	unknown	Het
Dip2b	A	G	15: 100,169,318	H567R	probably damaging	Het
Dnah7c	C	A	1: 46,430,809	A18E	probably benign	Het
Eif3d	A	T	15: 77,963,234	V268D	probably damaging	Het
Eif4g3	T	A	4: 138,171,186	H1089Q	probably damaging	Het
Fmnl2	A	G	2: 53,114,150	M625V	unknown	Het
Foxn1	T	C	11: 78,360,867	R513G	possibly damaging	Het
Gemin5	C	T	11: 58,166,002	V134I	probably benign	Het
Gm8251	A	T	1: 44,060,346	S531T	probably benign	Het
Gtf2h3	A	G	5: 124,590,370	R161G	probably damaging	Het
Ice1	A	G	13: 70,624,406		probably null	Het
Il1rl1	T	C	1: 40,446,606	Y306H	probably damaging	Het
Kbtbd7	A	T	14: 79,427,754	E342V	possibly damaging	Het
Kyat3	A	T	3: 142,737,839	K404N	possibly damaging	Het
Lins1	T	C	7: 66,713,805	W483R	probably benign	Het
Lipo2	A	G	19: 33,745,807	I194T	possibly damaging	Het
Mcm8	G	T	2: 132,820,072	A137S	probably benign	Het
Mdm1	C	A	10: 118,142,865	Q12K	probably damaging	Het
Mrgprb5	C	A	7: 48,168,311	L225F	possibly damaging	Het
Myh11	T	A	16: 14,215,826	H1068L		Het
Ngef	A	T	1: 87,480,695	V550E	possibly damaging	Het
Nrg1	G	A	8: 31,968,036	Q84*	probably null	Het
Obp2b	G	T	2: 25,737,748	V59L	possibly damaging	Het
Ocln	C	A	13: 100,515,082	G327C	probably damaging	Het
Ocln	A	C	13: 100,515,083	N326K	probably benign	Het
Olfr1117-ps1	C	T	2: 87,285,034	A248V	probably damaging	Het
Otogl	T	C	10: 107,778,911	D1960G	probably damaging	Het
Pik3c2a	T	C	7: 116,388,096	D530G	possibly damaging	Het
Plod1	A	T	4: 147,913,287	M655K	probably benign	Het
Ppp4r3b	A	G	11: 29,198,904	N449D	probably damaging	Het
Ppp6r3	G	T	19: 3,471,989	T563K	probably damaging	Het
Prepl	T	A	17: 85,069,026	L533F	probably benign	Het
Rbl1	G	A	2: 157,188,325	R421W	probably damaging	Het
Rrp15	G	A	1: 186,721,533	S239L	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Sbno1	A	G	5: 124,392,881	S815P	probably benign	Het
Scn7a	G	A	2: 66,676,288	T1419I	probably damaging	Het
Setdb1	A	G	3: 95,337,147		probably null	Het
Shpk	A	G	11: 73,222,988	H409R	probably benign	Het
Slamf6	A	C	1: 171,934,291	N93T	probably benign	Het
Slc27a4	A	G	2: 29,811,226	N343S	probably benign	Het
Slc35g1	T	A	19: 38,403,323	V351E	probably damaging	Het
Smcr8	A	T	11: 60,778,946	I307F	probably damaging	Het
Spats2l	T	C	1: 57,937,918	I305T	possibly damaging	Het
Speer4c	T	C	5: 15,711,538	T144A	probably benign	Het
Tbl3	G	A	17: 24,700,758	T774I	probably benign	Het
Ush2a	A	G	1: 188,537,728	H1724R	probably benign	Het
Vcan	A	G	13: 89,688,936	S2830P	probably benign	Het
Vmn2r27	T	A	6: 124,192,036	I712F	probably benign	Het
Wdr59	T	G	8: 111,492,756	Q223P		Het
Zfp28	T	A	7: 6,383,457	C22S	possibly damaging	Het
Zfp536	T	G	7: 37,480,851		probably null	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCATGGGCTCTATAATATAGCTC -3'
(R):5'- GCCCATGCACTGTGTGTTTC -3'

Sequencing Primer
(F):5'- GCTCTATAATATAGCTCAGTTGGGC -3'
(R):5'- GTGCAGTGACTGTTCCCACATG -3'

Posted On

2019-06-26