Incidental Mutation 'R7176:Aqp3'
ID 558608
Institutional Source Beutler Lab
Gene Symbol Aqp3
Ensembl Gene ENSMUSG00000028435
Gene Name aquaporin 3
Synonyms RP23-28I8.7, AQP-2, OTTMUSP00000006982, GIL, Gill blood group
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7176 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 41092722-41098183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41095202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 60 (N60Y)
Ref Sequence ENSEMBL: ENSMUSP00000055110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055327]
AlphaFold Q8R2N1
Predicted Effect probably damaging
Transcript: ENSMUST00000055327
AA Change: N60Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055110
Gene: ENSMUSG00000028435
AA Change: N60Y

DomainStartEndE-ValueType
Pfam:MIP 16 261 5.9e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Animals homozygous for a mutation in this gene display increased drinking behavior, increased urination, and decreased urine osmolality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gm8251 A T 1: 44,060,346 S531T probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kbtbd7 A T 14: 79,427,754 E342V possibly damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Obp2b G T 2: 25,737,748 V59L possibly damaging Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Pik3c2a T C 7: 116,388,096 D530G possibly damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slamf6 A C 1: 171,934,291 N93T probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Tbl3 G A 17: 24,700,758 T774I probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Aqp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Aqp3 APN 4 41093632 missense probably damaging 1.00
IGL02994:Aqp3 APN 4 41093614 missense probably benign 0.09
phoebus UTSW 4 41095252 missense probably benign 0.05
R0138:Aqp3 UTSW 4 41094843 splice site probably benign
R2097:Aqp3 UTSW 4 41098004 missense possibly damaging 0.95
R2128:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2129:Aqp3 UTSW 4 41098061 missense probably benign 0.00
R2278:Aqp3 UTSW 4 41093836 missense probably damaging 1.00
R5013:Aqp3 UTSW 4 41093819 missense probably damaging 1.00
R7365:Aqp3 UTSW 4 41098003 missense probably benign 0.14
R7385:Aqp3 UTSW 4 41095178 missense probably damaging 0.97
R9282:Aqp3 UTSW 4 41093640 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCAAAGCTGAGGTGCTGTTAG -3'
(R):5'- CCCAGTCATGTACCCATTACTG -3'

Sequencing Primer
(F):5'- AGGTGCTGTTAGTGTGCGTCC -3'
(R):5'- ATGAGGCTCTGCACGTCTC -3'
Posted On 2019-06-26