Incidental Mutation 'R0589:Slc35c1'
ID 55861
Institutional Source Beutler Lab
Gene Symbol Slc35c1
Ensembl Gene ENSMUSG00000049922
Gene Name solute carrier family 35, member C1
Synonyms E430007K15Rik, FUCT1
MMRRC Submission 038779-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.356) question?
Stock # R0589 (G1)
Quality Score 175
Status Validated
Chromosome 2
Chromosomal Location 92283109-92290863 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92284859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 252 (F252L)
Ref Sequence ENSEMBL: ENSMUSP00000119271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067631] [ENSMUST00000125276] [ENSMUST00000136718]
AlphaFold Q8BLX4
Predicted Effect probably damaging
Transcript: ENSMUST00000067631
AA Change: F265L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063461
Gene: ENSMUSG00000049922
AA Change: F265L

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
Pfam:TPT 38 336 5.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125276
AA Change: F252L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119271
Gene: ENSMUSG00000049922
AA Change: F252L

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
Pfam:UAA 27 330 2e-11 PFAM
Pfam:TPT 184 325 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136718
SMART Domains Protein: ENSMUSP00000137748
Gene: ENSMUSG00000049922

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
Pfam:UAA 27 158 4.5e-7 PFAM
Meta Mutation Damage Score 0.7220 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-fucose transporter that is found in the Golgi apparatus. Mutations in this gene result in congenital disorder of glycosylation type IIc. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit partial perinatal and postnatal lethality, growth retardation, reduced fertility, leukocytosis, defective lung and primary lymph node development and altered lymphocyte rolling and adhesion. Mortality is increased on an inbred background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,833,094 (GRCm39) A1202E probably damaging Het
Abcc12 A T 8: 87,287,101 (GRCm39) I155N possibly damaging Het
Atf4 T A 15: 80,140,640 (GRCm39) H47Q probably damaging Het
Atm T A 9: 53,401,492 (GRCm39) D1459V possibly damaging Het
Bicral A G 17: 47,112,522 (GRCm39) S893P probably benign Het
Camk2a G A 18: 61,097,036 (GRCm39) probably null Het
Cebpz G A 17: 79,244,308 (GRCm39) T51I probably damaging Het
Cers5 A T 15: 99,638,837 (GRCm39) D208E probably damaging Het
Cimip2b T C 4: 43,427,355 (GRCm39) probably benign Het
Cyp1a2 T C 9: 57,586,345 (GRCm39) D391G possibly damaging Het
Dct G T 14: 118,280,682 (GRCm39) F111L probably benign Het
Ddb1 T G 19: 10,599,080 (GRCm39) I529S probably benign Het
Dhx9 G T 1: 153,348,037 (GRCm39) Q361K probably damaging Het
Dnai3 A G 3: 145,768,086 (GRCm39) S592P probably benign Het
Erbin G T 13: 104,022,795 (GRCm39) R15S probably damaging Het
F13b T C 1: 139,434,671 (GRCm39) S146P possibly damaging Het
Ggnbp2 A T 11: 84,727,277 (GRCm39) C520S probably damaging Het
Gpx3 A G 11: 54,800,329 (GRCm39) I208V probably benign Het
Grk3 A G 5: 113,076,629 (GRCm39) probably benign Het
Heatr9 T C 11: 83,405,516 (GRCm39) probably benign Het
Heg1 T G 16: 33,552,077 (GRCm39) I762R probably damaging Het
Ints11 A T 4: 155,971,343 (GRCm39) T264S probably damaging Het
Ints14 T C 9: 64,887,113 (GRCm39) L348P probably damaging Het
Maco1 C A 4: 134,555,528 (GRCm39) C315F probably benign Het
Marf1 C A 16: 13,959,919 (GRCm39) probably benign Het
Med13 A G 11: 86,174,075 (GRCm39) Y1808H probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Mrpl45 A T 11: 97,214,714 (GRCm39) T134S probably benign Het
Myh8 A G 11: 67,189,453 (GRCm39) I1210V probably benign Het
Nsd3 T C 8: 26,131,303 (GRCm39) S223P probably damaging Het
Or2j6 T G 7: 139,980,813 (GRCm39) S49R possibly damaging Het
Or4c115 A G 2: 88,927,606 (GRCm39) F222L probably benign Het
Or5be3 A T 2: 86,864,459 (GRCm39) Y35* probably null Het
P3h3 T A 6: 124,818,644 (GRCm39) E731D probably damaging Het
Pcdhac2 A G 18: 37,279,527 (GRCm39) R836G probably benign Het
Pdzd2 A G 15: 12,376,385 (GRCm39) V1250A probably benign Het
Pgbd1 G A 13: 21,618,600 (GRCm39) T19I possibly damaging Het
Phtf2 T A 5: 21,018,249 (GRCm39) R31* probably null Het
Plod2 T A 9: 92,475,799 (GRCm39) V294D probably benign Het
Rassf5 C T 1: 131,172,720 (GRCm39) G50R probably damaging Het
Rexo5 A G 7: 119,444,606 (GRCm39) T694A probably benign Het
Rtcb A C 10: 85,787,315 (GRCm39) S82A probably damaging Het
Rufy4 T C 1: 74,172,042 (GRCm39) L255P probably damaging Het
Slco6d1 A T 1: 98,427,472 (GRCm39) probably benign Het
Sox10 T G 15: 79,047,485 (GRCm39) probably benign Het
Stard9 A G 2: 120,529,028 (GRCm39) M1762V probably benign Het
Stat3 A T 11: 100,798,909 (GRCm39) Y94N probably damaging Het
Tasor T C 14: 27,183,107 (GRCm39) I522T probably benign Het
Tecta T A 9: 42,256,930 (GRCm39) Y1582F probably benign Het
Tex44 A G 1: 86,355,453 (GRCm39) D454G probably damaging Het
Tle6 A G 10: 81,431,253 (GRCm39) probably benign Het
Tmod2 T C 9: 75,484,041 (GRCm39) E303G probably damaging Het
Trem1 A G 17: 48,544,245 (GRCm39) D90G possibly damaging Het
Trhde A T 10: 114,284,229 (GRCm39) D751E probably benign Het
Ttn A T 2: 76,795,589 (GRCm39) probably null Het
Vars2 T C 17: 35,970,068 (GRCm39) T774A probably benign Het
Other mutations in Slc35c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Slc35c1 APN 2 92,284,703 (GRCm39) missense probably benign 0.00
IGL00931:Slc35c1 APN 2 92,289,239 (GRCm39) missense probably benign 0.00
R0350:Slc35c1 UTSW 2 92,289,377 (GRCm39) missense probably damaging 1.00
R0458:Slc35c1 UTSW 2 92,284,858 (GRCm39) missense probably damaging 0.98
R1878:Slc35c1 UTSW 2 92,289,398 (GRCm39) missense probably benign 0.00
R1997:Slc35c1 UTSW 2 92,284,984 (GRCm39) missense probably benign 0.04
R2329:Slc35c1 UTSW 2 92,289,040 (GRCm39) nonsense probably null
R2473:Slc35c1 UTSW 2 92,285,098 (GRCm39) missense probably benign 0.32
R2568:Slc35c1 UTSW 2 92,289,225 (GRCm39) missense probably benign 0.00
R4583:Slc35c1 UTSW 2 92,289,266 (GRCm39) missense probably damaging 1.00
R4761:Slc35c1 UTSW 2 92,289,168 (GRCm39) missense probably damaging 0.99
R5021:Slc35c1 UTSW 2 92,289,366 (GRCm39) missense possibly damaging 0.61
R7296:Slc35c1 UTSW 2 92,289,084 (GRCm39) missense probably damaging 1.00
R7877:Slc35c1 UTSW 2 92,289,402 (GRCm39) missense probably damaging 1.00
R8446:Slc35c1 UTSW 2 92,284,707 (GRCm39) missense probably benign 0.00
R8519:Slc35c1 UTSW 2 92,285,052 (GRCm39) missense probably benign 0.05
Z1176:Slc35c1 UTSW 2 92,289,105 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTATTGCTCAGGGCCATACCCAG -3'
(R):5'- TCTATACCAAGAAGGTGCTCCCTGC -3'

Sequencing Primer
(F):5'- TTGCTTGTCCACCACAGGAAG -3'
(R):5'- TGCAGTAGACCACAGTATCTG -3'
Posted On 2013-07-11