Mutagenetix > Incidental Mutation

Incidental Mutation 'R7176:Pik3c2a'

558622

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7176 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116337265-116443449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116388096 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 530 (D530G)

Ref Sequence

ENSEMBL: ENSMUSP00000126092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170430
AA Change: D530G

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: D530G

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205378

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206219
AA Change: D530G

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	G	T	17: 46,324,277	H267N	probably benign	Het
Abtb2	A	G	2: 103,709,375	D695G	probably benign	Het
Adam21	C	T	12: 81,560,248	D247N	possibly damaging	Het
Adnp	T	C	2: 168,182,658	N906D	probably benign	Het
Ankrd17	A	T	5: 90,268,735	H1079Q	probably damaging	Het
Aqp3	T	A	4: 41,095,202	N60Y	probably damaging	Het
Art4	T	G	6: 136,857,168	T26P	probably benign	Het
Arvcf	T	C	16: 18,399,727	L553P	probably damaging	Het
Asxl1	T	A	2: 153,401,988	I1487N	probably damaging	Het
Capn3	A	T	2: 120,504,492	Y820F	possibly damaging	Het
Catip	A	G	1: 74,362,782	T39A	probably damaging	Het
Ccdc18	T	A	5: 108,168,106	C481S	probably benign	Het
Ccnf	A	G	17: 24,249,402	I7T	possibly damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdkl4	A	T	17: 80,543,792	Y160*	probably null	Het
Celsr3	C	T	9: 108,845,762	P2783S	probably benign	Het
Cisd3	A	T	11: 97,686,133	D11V	probably benign	Het
Daxx	A	T	17: 33,913,318	H512L	unknown	Het
Dip2b	A	G	15: 100,169,318	H567R	probably damaging	Het
Dnah7c	C	A	1: 46,430,809	A18E	probably benign	Het
Eif3d	A	T	15: 77,963,234	V268D	probably damaging	Het
Eif4g3	T	A	4: 138,171,186	H1089Q	probably damaging	Het
Fmnl2	A	G	2: 53,114,150	M625V	unknown	Het
Foxn1	T	C	11: 78,360,867	R513G	possibly damaging	Het
Gemin5	C	T	11: 58,166,002	V134I	probably benign	Het
Gm8251	A	T	1: 44,060,346	S531T	probably benign	Het
Gtf2h3	A	G	5: 124,590,370	R161G	probably damaging	Het
Ice1	A	G	13: 70,624,406		probably null	Het
Il1rl1	T	C	1: 40,446,606	Y306H	probably damaging	Het
Kbtbd7	A	T	14: 79,427,754	E342V	possibly damaging	Het
Kyat3	A	T	3: 142,737,839	K404N	possibly damaging	Het
Lins1	T	C	7: 66,713,805	W483R	probably benign	Het
Lipo2	A	G	19: 33,745,807	I194T	possibly damaging	Het
Mcm8	G	T	2: 132,820,072	A137S	probably benign	Het
Mdm1	C	A	10: 118,142,865	Q12K	probably damaging	Het
Mrgprb5	C	A	7: 48,168,311	L225F	possibly damaging	Het
Myh11	T	A	16: 14,215,826	H1068L		Het
Ngef	A	T	1: 87,480,695	V550E	possibly damaging	Het
Nrg1	G	A	8: 31,968,036	Q84*	probably null	Het
Obp2b	G	T	2: 25,737,748	V59L	possibly damaging	Het
Ocln	C	A	13: 100,515,082	G327C	probably damaging	Het
Ocln	A	C	13: 100,515,083	N326K	probably benign	Het
Olfr1117-ps1	C	T	2: 87,285,034	A248V	probably damaging	Het
Otogl	T	C	10: 107,778,911	D1960G	probably damaging	Het
Plod1	A	T	4: 147,913,287	M655K	probably benign	Het
Ppp4r3b	A	G	11: 29,198,904	N449D	probably damaging	Het
Ppp6r3	G	T	19: 3,471,989	T563K	probably damaging	Het
Prepl	T	A	17: 85,069,026	L533F	probably benign	Het
Rbl1	G	A	2: 157,188,325	R421W	probably damaging	Het
Rrp15	G	A	1: 186,721,533	S239L	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Sbno1	A	G	5: 124,392,881	S815P	probably benign	Het
Scn7a	G	A	2: 66,676,288	T1419I	probably damaging	Het
Setdb1	A	G	3: 95,337,147		probably null	Het
Shpk	A	G	11: 73,222,988	H409R	probably benign	Het
Slamf6	A	C	1: 171,934,291	N93T	probably benign	Het
Slc27a4	A	G	2: 29,811,226	N343S	probably benign	Het
Slc35g1	T	A	19: 38,403,323	V351E	probably damaging	Het
Smcr8	A	T	11: 60,778,946	I307F	probably damaging	Het
Spats2l	T	C	1: 57,937,918	I305T	possibly damaging	Het
Speer4c	T	C	5: 15,711,538	T144A	probably benign	Het
Tbl3	G	A	17: 24,700,758	T774I	probably benign	Het
Ush2a	A	G	1: 188,537,728	H1724R	probably benign	Het
Vcan	A	G	13: 89,688,936	S2830P	probably benign	Het
Vmn2r27	T	A	6: 124,192,036	I712F	probably benign	Het
Wdr59	T	G	8: 111,492,756	Q223P		Het
Zfp28	T	A	7: 6,383,457	C22S	possibly damaging	Het
Zfp536	T	G	7: 37,480,851		probably null	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	116376283	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	116364500	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	116373803	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116418194	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	116376250	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	116350765	intron	probably benign
IGL01695:Pik3c2a	APN	7	116417518	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	116346188	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	116350804	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	116388064	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	116363340	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116405891	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	116372814	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	116364513	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116418021	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116417839	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	116354072	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	116373744	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	116354055	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	116346247	splice site	probably benign
R0991:Pik3c2a	UTSW	7	116362045	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	116350925	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116417673	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	116388065	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	116388045	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	116368848	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116417927	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116418520	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	116346236	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116417664	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	116376512	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	116368117	missense	probably benign
R1875:Pik3c2a	UTSW	7	116417971	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	116354006	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	116342237	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	116364503	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	116350931	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	116350822	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116417451	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	116372891	nonsense	probably null
R3814:Pik3c2a	UTSW	7	116348179	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	116364550	nonsense	probably null
R4386:Pik3c2a	UTSW	7	116354099	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	116358688	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116417825	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	116340156	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	116376283	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	116348274	missense	probably damaging	1.00
R5083:Pik3c2a	UTSW	7	116342401	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	116350786	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116417658	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116405951	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	116368184	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	116362564	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	116348205	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116417496	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	116340225	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	116368758	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	116362184	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	116394305	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116417988	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116418133	nonsense	probably null
R7153:Pik3c2a	UTSW	7	116342252	missense	probably damaging	1.00
R7265:Pik3c2a	UTSW	7	116388086	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116405943	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	116373839	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	116376386	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	116354007	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	116372854	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	116394239	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	116340096	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	116388077	nonsense	probably null
R7737:Pik3c2a	UTSW	7	116356253	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	116394294	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116417458	missense	probably benign
R7922:Pik3c2a	UTSW	7	116391282	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	116350115	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116418036	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	116342997	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116418048	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116418349	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	116376229	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	116351877	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116418424	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	116388085	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	116372814	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	116394296	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116417769	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116417880	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	116346178	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	116391323	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	116362054	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	116340086	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	116358704	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	116346192	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGGTATCATGGCTGAAGAC -3'
(R):5'- ACAGCAAGTACTTTTAACCTCTGAGC -3'

Sequencing Primer
(F):5'- GGTATCATGGCTGAAGACTATTTTAG -3'
(R):5'- AACCTCTGAGCCATCTCTGCAG -3'

Posted On

2019-06-26