Incidental Mutation 'R7176:Pik3c2a'
ID558622
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7176 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116388096 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 530 (D530G)
Ref Sequence ENSEMBL: ENSMUSP00000126092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170430
AA Change: D530G

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: D530G

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205378
Predicted Effect possibly damaging
Transcript: ENSMUST00000206219
AA Change: D530G

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Aqp3 T A 4: 41,095,202 N60Y probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gm8251 A T 1: 44,060,346 S531T probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kbtbd7 A T 14: 79,427,754 E342V possibly damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Obp2b G T 2: 25,737,748 V59L possibly damaging Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slamf6 A C 1: 171,934,291 N93T probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Tbl3 G A 17: 24,700,758 T774I probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 116388077 nonsense probably null
R7737:Pik3c2a UTSW 7 116356253 missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 116394294 missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116417458 missense probably benign
R7935:Pik3c2a UTSW 7 116417458 missense probably benign
R8005:Pik3c2a UTSW 7 116418036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGTATCATGGCTGAAGAC -3'
(R):5'- ACAGCAAGTACTTTTAACCTCTGAGC -3'

Sequencing Primer
(F):5'- GGTATCATGGCTGAAGACTATTTTAG -3'
(R):5'- AACCTCTGAGCCATCTCTGCAG -3'
Posted On2019-06-26