Incidental Mutation 'R7177:Col9a1'
ID558655
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Namecollagen, type IX, alpha 1
SynonymsCol9a-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location24177610-24252684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24195417 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 13 (L13Q)
Ref Sequence ENSEMBL: ENSMUSP00000085687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588] [ENSMUST00000088349]
Predicted Effect probably benign
Transcript: ENSMUST00000054588
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000088349
AA Change: L13Q
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147
AA Change: L13Q

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24185225 missense unknown
IGL00517:Col9a1 APN 1 24195534 intron probably benign
IGL01125:Col9a1 APN 1 24224645 critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24185124 missense unknown
IGL01583:Col9a1 APN 1 24185144 missense unknown
IGL01627:Col9a1 APN 1 24179608 critical splice donor site probably null
IGL01773:Col9a1 APN 1 24205066 missense probably benign 0.17
IGL02117:Col9a1 APN 1 24237493 nonsense probably null
IGL02192:Col9a1 APN 1 24221987 missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24223609 missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24185258 missense unknown
IGL02453:Col9a1 APN 1 24179357 missense unknown
IGL02553:Col9a1 APN 1 24221937 splice site probably benign
IGL03412:Col9a1 APN 1 24210427 critical splice donor site probably null
IGL03493:Col9a1 APN 1 24221570 splice site probably benign
ANU74:Col9a1 UTSW 1 24185328 missense unknown
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0090:Col9a1 UTSW 1 24223562 splice site probably null
R0356:Col9a1 UTSW 1 24185247 nonsense probably null
R0562:Col9a1 UTSW 1 24179279 splice site probably null
R0584:Col9a1 UTSW 1 24224490 splice site probably benign
R0708:Col9a1 UTSW 1 24237261 missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24223620 critical splice donor site probably null
R1445:Col9a1 UTSW 1 24237498 critical splice donor site probably null
R1791:Col9a1 UTSW 1 24185305 missense unknown
R1938:Col9a1 UTSW 1 24222473 missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24208202 missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24179501 missense unknown
R3757:Col9a1 UTSW 1 24232231 critical splice donor site probably null
R3891:Col9a1 UTSW 1 24185436 critical splice donor site probably null
R4249:Col9a1 UTSW 1 24244381 missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24224706 splice site probably null
R4918:Col9a1 UTSW 1 24237258 missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24185192 missense unknown
R5144:Col9a1 UTSW 1 24239353 missense probably benign 0.08
R5327:Col9a1 UTSW 1 24195539 critical splice donor site probably null
R5511:Col9a1 UTSW 1 24179538 missense unknown
R5519:Col9a1 UTSW 1 24230254 splice site probably null
R5564:Col9a1 UTSW 1 24195355 start gained probably benign
R6076:Col9a1 UTSW 1 24195376 start gained probably benign
R6478:Col9a1 UTSW 1 24185405 missense unknown
R6886:Col9a1 UTSW 1 24185345 missense unknown
R7259:Col9a1 UTSW 1 24185343 missense unknown
R7268:Col9a1 UTSW 1 24207398 missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24179403 intron probably null
R7644:Col9a1 UTSW 1 24185162 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGAAACCCAGGTCCCCTTG -3'
(R):5'- GGGTACTCTGACTTCTCACACC -3'

Sequencing Primer
(F):5'- TTGGCCAGGCACCTTTG -3'
(R):5'- GTACTCTGACTTCTCACACCCAGAAC -3'
Posted On2019-06-26