Incidental Mutation 'R7177:Zdbf2'
ID 558656
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 045268-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63334120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 31 (R31C)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132] [ENSMUST00000126932]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: R31C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: R31C

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: R31C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: R31C

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126932
AA Change: R31C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T C 9: 53,325,685 (GRCm39) L74S probably damaging Het
5730409E04Rik A G 4: 126,505,525 (GRCm39) S18G probably benign Het
Adam29 A G 8: 56,325,659 (GRCm39) I265T probably benign Het
Aff4 C T 11: 53,297,466 (GRCm39) S896L probably benign Het
Ankrd27 T C 7: 35,318,822 (GRCm39) I571T probably damaging Het
Bdp1 C A 13: 100,186,478 (GRCm39) R1658I probably damaging Het
Carm1 C T 9: 21,458,323 (GRCm39) T7M unknown Het
Ccdc183 A G 2: 25,506,296 (GRCm39) V100A probably damaging Het
Cd86 CA CAA 16: 36,426,917 (GRCm39) probably null Het
Ceacam2 T G 7: 25,220,341 (GRCm39) D239A probably benign Het
Cfap96 T A 8: 46,423,444 (GRCm39) E89D possibly damaging Het
Cimap1c T A 9: 56,757,262 (GRCm39) M139L possibly damaging Het
Cmya5 T C 13: 93,231,836 (GRCm39) D1084G probably benign Het
Cog5 T A 12: 31,810,888 (GRCm39) I194K probably damaging Het
Col20a1 C T 2: 180,636,007 (GRCm39) Q211* probably null Het
Col9a1 T A 1: 24,234,498 (GRCm39) L13Q unknown Het
Cracr2a A T 6: 127,585,669 (GRCm39) M156L probably benign Het
Cts8 C T 13: 61,399,505 (GRCm39) M151I possibly damaging Het
Cyp2ab1 A T 16: 20,135,469 (GRCm39) L11Q probably null Het
Dhrs13 T A 11: 77,925,208 (GRCm39) C160S probably benign Het
Enthd1 T A 15: 80,358,415 (GRCm39) E368D probably damaging Het
Fbh1 A G 2: 11,760,522 (GRCm39) I676T probably damaging Het
Fcgrt T C 7: 44,751,421 (GRCm39) R176G probably benign Het
Gatd1 A G 7: 140,990,947 (GRCm39) F67L possibly damaging Het
Gm4353 G A 7: 115,683,727 (GRCm39) P23S probably damaging Het
Gm6882 T A 7: 21,161,677 (GRCm39) I64F possibly damaging Het
Grwd1 A T 7: 45,480,204 (GRCm39) M1K probably null Het
Hook2 T A 8: 85,718,046 (GRCm39) S58T probably benign Het
Iqch T G 9: 63,329,117 (GRCm39) *1072C probably null Het
Kmt2d G A 15: 98,748,267 (GRCm39) T3019I unknown Het
Lmx1a T C 1: 167,674,247 (GRCm39) S356P probably benign Het
Lrig3 A G 10: 125,842,712 (GRCm39) M546V probably benign Het
Lrrc1 C A 9: 77,379,504 (GRCm39) E96* probably null Het
Lrtm2 C A 6: 119,294,113 (GRCm39) M339I probably damaging Het
Map10 T C 8: 126,398,584 (GRCm39) V659A probably benign Het
Map7d1 A G 4: 126,130,778 (GRCm39) C384R probably damaging Het
Mcur1 T C 13: 43,698,012 (GRCm39) D296G probably damaging Het
Mettl24 A T 10: 40,686,508 (GRCm39) H295L probably damaging Het
Mgat4f T C 1: 134,318,163 (GRCm39) S312P probably benign Het
Mpl A G 4: 118,305,741 (GRCm39) probably null Het
Mrps5 T C 2: 127,437,617 (GRCm39) V148A probably benign Het
N4bp2 T C 5: 65,964,891 (GRCm39) V980A probably damaging Het
Ncaph A T 2: 126,958,506 (GRCm39) D504E probably damaging Het
Nxph1 A G 6: 9,247,497 (GRCm39) N156S probably damaging Het
Or2t26 T A 11: 49,040,012 (GRCm39) C309* probably null Het
Or4f14b T A 2: 111,775,501 (GRCm39) Q100L probably damaging Het
Pafah1b3 T A 7: 24,994,657 (GRCm39) I186L probably benign Het
Papola C A 12: 105,775,790 (GRCm39) N235K possibly damaging Het
Pcnx3 A T 19: 5,737,527 (GRCm39) M98K probably benign Het
Pip4p1 A C 14: 51,167,634 (GRCm39) M104R possibly damaging Het
Pkhd1l1 A G 15: 44,330,800 (GRCm39) N125S probably damaging Het
Pls1 T A 9: 95,655,612 (GRCm39) H380L probably benign Het
Plxna1 T C 6: 89,300,311 (GRCm39) T1591A possibly damaging Het
Pparg T G 6: 115,418,581 (GRCm39) S147A probably benign Het
Prdm10 T C 9: 31,279,003 (GRCm39) S1025P probably benign Het
Prkcd T A 14: 30,321,664 (GRCm39) H510L probably damaging Het
Ptprh T A 7: 4,572,480 (GRCm39) E499D possibly damaging Het
Rad51ap1 A G 6: 126,901,983 (GRCm39) S256P probably benign Het
Rad54b A G 4: 11,599,755 (GRCm39) T320A probably damaging Het
Rnf207 A G 4: 152,396,634 (GRCm39) I459T probably benign Het
Runx2 G A 17: 45,125,079 (GRCm39) P80L probably damaging Het
Ryr3 A T 2: 112,731,188 (GRCm39) D727E probably damaging Het
Sdk2 C T 11: 113,720,795 (GRCm39) R1378H possibly damaging Het
Slc7a11 A G 3: 50,397,680 (GRCm39) S11P probably benign Het
Sox4 A G 13: 29,137,000 (GRCm39) V2A probably damaging Het
Srf A G 17: 46,866,318 (GRCm39) F146S probably damaging Het
Srrm2 T C 17: 24,035,747 (GRCm39) V797A unknown Het
Stk32c T C 7: 138,684,218 (GRCm39) D463G possibly damaging Het
Syne2 C A 12: 76,018,654 (GRCm39) Y3384* probably null Het
Tektl1 T C 10: 78,588,324 (GRCm39) D162G probably damaging Het
Traip T A 9: 107,838,184 (GRCm39) M139K possibly damaging Het
Trappc2l T A 8: 123,341,051 (GRCm39) F100Y probably damaging Het
Ush1c T C 7: 45,878,643 (GRCm39) D124G probably damaging Het
Uty A G Y: 1,099,691 (GRCm39) V1168A probably benign Het
Vmn2r25 T C 6: 123,816,882 (GRCm39) D233G possibly damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTTTTGATGTCATCCTTAGGAATG -3'
(R):5'- CCAGTCCTGGGATACACATC -3'

Sequencing Primer
(F):5'- GGTTTTAGATGCATATAGTAGAGGTG -3'
(R):5'- TCCTGGGATACACATCAAGATG -3'
Posted On 2019-06-26