Mutagenetix > Incidental Mutation

Incidental Mutation 'R7177:Zdbf2'

558656

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R7177 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 63294961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 31 (R31C)

Ref Sequence

ENSEMBL: ENSMUSP00000029025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132] [ENSMUST00000126932]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: R31C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: R31C

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: R31C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: R31C

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126932
AA Change: R31C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	T	A	8: 45,970,407	E89D	possibly damaging	Het
4930550C14Rik	T	C	9: 53,414,385	L74S	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,425	S312P	probably benign	Het
5730409E04Rik	A	G	4: 126,611,732	S18G	probably benign	Het
Adam29	A	G	8: 55,872,624	I265T	probably benign	Het
Aff4	C	T	11: 53,406,639	S896L	probably benign	Het
Ankrd27	T	C	7: 35,619,397	I571T	probably damaging	Het
Bdp1	C	A	13: 100,049,970	R1658I	probably damaging	Het
Carm1	C	T	9: 21,547,027	T7M	unknown	Het
Ccdc105	T	C	10: 78,752,490	D162G	probably damaging	Het
Ccdc183	A	G	2: 25,616,284	V100A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Ceacam2	T	G	7: 25,520,916	D239A	probably benign	Het
Cmya5	T	C	13: 93,095,328	D1084G	probably benign	Het
Cog5	T	A	12: 31,760,889	I194K	probably damaging	Het
Col20a1	C	T	2: 180,994,214	Q211*	probably null	Het
Col9a1	T	A	1: 24,195,417	L13Q	unknown	Het
Cracr2a	A	T	6: 127,608,706	M156L	probably benign	Het
Cts8	C	T	13: 61,251,691	M151I	possibly damaging	Het
Cyp2ab1	A	T	16: 20,316,719	L11Q	probably null	Het
Dhrs13	T	A	11: 78,034,382	C160S	probably benign	Het
Enthd1	T	A	15: 80,474,214	E368D	probably damaging	Het
Fbxo18	A	G	2: 11,755,711	I676T	probably damaging	Het
Fcgrt	T	C	7: 45,101,997	R176G	probably benign	Het
Gatd1	A	G	7: 141,411,034	F67L	possibly damaging	Het
Gm4353	G	A	7: 116,084,492	P23S	probably damaging	Het
Gm6882	T	A	7: 21,427,752	I64F	possibly damaging	Het
Grwd1	A	T	7: 45,830,780	M1K	probably null	Het
Hook2	T	A	8: 84,991,417	S58T	probably benign	Het
Iqch	T	G	9: 63,421,835	*1072C	probably null	Het
Kmt2d	G	A	15: 98,850,386	T3019I	unknown	Het
Lmx1a	T	C	1: 167,846,678	S356P	probably benign	Het
Lrig3	A	G	10: 126,006,843	M546V	probably benign	Het
Lrrc1	C	A	9: 77,472,222	E96*	probably null	Het
Lrtm2	C	A	6: 119,317,152	M339I	probably damaging	Het
Map10	T	C	8: 125,671,845	V659A	probably benign	Het
Map7d1	A	G	4: 126,236,985	C384R	probably damaging	Het
Mcur1	T	C	13: 43,544,536	D296G	probably damaging	Het
Mettl24	A	T	10: 40,810,512	H295L	probably damaging	Het
Mpl	A	G	4: 118,448,544		probably null	Het
Mrps5	T	C	2: 127,595,697	V148A	probably benign	Het
N4bp2	T	C	5: 65,807,548	V980A	probably damaging	Het
Ncaph	A	T	2: 127,116,586	D504E	probably damaging	Het
Nxph1	A	G	6: 9,247,497	N156S	probably damaging	Het
Odf3l1	T	A	9: 56,849,978	M139L	possibly damaging	Het
Olfr1307	T	A	2: 111,945,156	Q100L	probably damaging	Het
Olfr1395	T	A	11: 49,149,185	C309*	probably null	Het
Pafah1b3	T	A	7: 25,295,232	I186L	probably benign	Het
Papola	C	A	12: 105,809,531	N235K	possibly damaging	Het
Pcnx3	A	T	19: 5,687,499	M98K	probably benign	Het
Pkhd1l1	A	G	15: 44,467,404	N125S	probably damaging	Het
Pls1	T	A	9: 95,773,559	H380L	probably benign	Het
Plxna1	T	C	6: 89,323,329	T1591A	possibly damaging	Het
Pparg	T	G	6: 115,441,620	S147A	probably benign	Het
Prdm10	T	C	9: 31,367,707	S1025P	probably benign	Het
Prkcd	T	A	14: 30,599,707	H510L	probably damaging	Het
Ptprh	T	A	7: 4,569,481	E499D	possibly damaging	Het
Rad51ap1	A	G	6: 126,925,020	S256P	probably benign	Het
Rad54b	A	G	4: 11,599,755	T320A	probably damaging	Het
Rnf207	A	G	4: 152,312,177	I459T	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Ryr3	A	T	2: 112,900,843	D727E	probably damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Slc7a11	A	G	3: 50,443,231	S11P	probably benign	Het
Sox4	A	G	13: 28,953,017	V2A	probably damaging	Het
Srf	A	G	17: 46,555,392	F146S	probably damaging	Het
Srrm2	T	C	17: 23,816,773	V797A	unknown	Het
Stk32c	T	C	7: 139,104,302	D463G	possibly damaging	Het
Syne2	C	A	12: 75,971,880	Y3384*	probably null	Het
Tmem55b	A	C	14: 50,930,177	M104R	possibly damaging	Het
Traip	T	A	9: 107,960,985	M139K	possibly damaging	Het
Trappc2l	T	A	8: 122,614,312	F100Y	probably damaging	Het
Ush1c	T	C	7: 46,229,219	D124G	probably damaging	Het
Uty	A	G	Y: 1,099,691	V1168A	probably benign	Het
Vmn2r25	T	C	6: 123,839,923	D233G	possibly damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCTTTTGATGTCATCCTTAGGAATG -3'
(R):5'- CCAGTCCTGGGATACACATC -3'

Sequencing Primer
(F):5'- GGTTTTAGATGCATATAGTAGAGGTG -3'
(R):5'- TCCTGGGATACACATCAAGATG -3'

Posted On

2019-06-26