Incidental Mutation 'R7177:Col20a1'
ID558665
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Namecollagen, type XX, alpha 1
Synonyms1700051I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location180986535-181018363 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 180994214 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 211 (Q211*)
Ref Sequence ENSEMBL: ENSMUSP00000104484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
Predicted Effect probably null
Transcript: ENSMUST00000108856
AA Change: Q211*
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: Q211*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149179
AA Change: Q169*
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: Q169*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000228434
AA Change: Q169*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 unclassified probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGAGAAGCCGAAACCCC -3'
(R):5'- AGCTGCTGTCCTTCTGCTAG -3'

Sequencing Primer
(F):5'- CAAACTAGGATGCAAGAAGGTTTTTC -3'
(R):5'- GTCCTTCTGCTAGTGAGAACTCAAG -3'
Posted On2019-06-26