Mutagenetix > Incidental Mutations

Incidental Mutation 'R7177:Mpl'

558668

Institutional Source

Beutler Lab

Gene Symbol

Mpl

Ensembl Gene

ENSMUSG00000006389

Gene Name

myeloproliferative leukemia virus oncogene

Synonyms

TPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7177 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118442415-118457513 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 118448544 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000006556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000102671] [ENSMUST00000106375] [ENSMUST00000106375]

Predicted Effect

probably null
Transcript: ENSMUST00000006556

SMART Domains

Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	1.9e-31	PFAM
Pfam:IL6Ra-bind	27	118	1.8e-7	PFAM
FN3	126	257	7.7e-3	SMART
FN3	382	461	2.83e0	SMART
transmembrane domain	483	505	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000006556

SMART Domains

Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	1.9e-31	PFAM
Pfam:IL6Ra-bind	27	118	1.8e-7	PFAM
FN3	126	257	7.7e-3	SMART
FN3	382	461	2.83e0	SMART
transmembrane domain	483	505	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102671

SMART Domains

Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.4e-32	PFAM
Pfam:IL6Ra-bind	34	125	7.3e-9	PFAM
FN3	133	256	1.09e-2	SMART
FN3	381	460	2.83e0	SMART
transmembrane domain	482	504	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102671

SMART Domains

Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.4e-32	PFAM
Pfam:IL6Ra-bind	34	125	7.3e-9	PFAM
FN3	133	256	1.09e-2	SMART
FN3	381	460	2.83e0	SMART
transmembrane domain	482	504	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106375

SMART Domains

Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	9.4e-32	PFAM
Pfam:IL6Ra-bind	27	119	7.4e-8	PFAM
FN3	322	401	2.83e0	SMART
transmembrane domain	423	445	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106375

SMART Domains

Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	18	121	9.4e-32	PFAM
Pfam:IL6Ra-bind	27	119	7.4e-8	PFAM
FN3	322	401	2.83e0	SMART
transmembrane domain	423	445	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168404

SMART Domains

Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.9e-31	PFAM
FN3	133	264	7.7e-3	SMART
FN3	389	468	2.83e0	SMART
transmembrane domain	490	512	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168404

SMART Domains

Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

Domain	Start	End	E-Value	Type
Pfam:EpoR_lig-bind	25	128	1.9e-31	PFAM
FN3	133	264	7.7e-3	SMART
FN3	389	468	2.83e0	SMART
transmembrane domain	490	512	N/A	INTRINSIC

Meta Mutation Damage Score

0.9493

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	T	A	8: 45,970,407	E89D	possibly damaging	Het
4930550C14Rik	T	C	9: 53,414,385	L74S	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,425	S312P	probably benign	Het
5730409E04Rik	A	G	4: 126,611,732	S18G	probably benign	Het
Adam29	A	G	8: 55,872,624	I265T	probably benign	Het
Aff4	C	T	11: 53,406,639	S896L	probably benign	Het
Ankrd27	T	C	7: 35,619,397	I571T	probably damaging	Het
Bdp1	C	A	13: 100,049,970	R1658I	probably damaging	Het
Carm1	C	T	9: 21,547,027	T7M	unknown	Het
Ccdc105	T	C	10: 78,752,490	D162G	probably damaging	Het
Ccdc183	A	G	2: 25,616,284	V100A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Ceacam2	T	G	7: 25,520,916	D239A	probably benign	Het
Cmya5	T	C	13: 93,095,328	D1084G	probably benign	Het
Cog5	T	A	12: 31,760,889	I194K	probably damaging	Het
Col20a1	C	T	2: 180,994,214	Q211*	probably null	Het
Col9a1	T	A	1: 24,195,417	L13Q	unknown	Het
Cracr2a	A	T	6: 127,608,706	M156L	probably benign	Het
Cts8	C	T	13: 61,251,691	M151I	possibly damaging	Het
Cyp2ab1	A	T	16: 20,316,719	L11Q	probably null	Het
Dhrs13	T	A	11: 78,034,382	C160S	probably benign	Het
Enthd1	T	A	15: 80,474,214	E368D	probably damaging	Het
Fbxo18	A	G	2: 11,755,711	I676T	probably damaging	Het
Fcgrt	T	C	7: 45,101,997	R176G	probably benign	Het
Gatd1	A	G	7: 141,411,034	F67L	possibly damaging	Het
Gm4353	G	A	7: 116,084,492	P23S	probably damaging	Het
Gm6882	T	A	7: 21,427,752	I64F	possibly damaging	Het
Grwd1	A	T	7: 45,830,780	M1K	probably null	Het
Hook2	T	A	8: 84,991,417	S58T	probably benign	Het
Iqch	T	G	9: 63,421,835	*1072C	probably null	Het
Kmt2d	G	A	15: 98,850,386	T3019I	unknown	Het
Lmx1a	T	C	1: 167,846,678	S356P	probably benign	Het
Lrig3	A	G	10: 126,006,843	M546V	probably benign	Het
Lrrc1	C	A	9: 77,472,222	E96*	probably null	Het
Lrtm2	C	A	6: 119,317,152	M339I	probably damaging	Het
Map10	T	C	8: 125,671,845	V659A	probably benign	Het
Map7d1	A	G	4: 126,236,985	C384R	probably damaging	Het
Mcur1	T	C	13: 43,544,536	D296G	probably damaging	Het
Mettl24	A	T	10: 40,810,512	H295L	probably damaging	Het
Mrps5	T	C	2: 127,595,697	V148A	probably benign	Het
N4bp2	T	C	5: 65,807,548	V980A	probably damaging	Het
Ncaph	A	T	2: 127,116,586	D504E	probably damaging	Het
Nxph1	A	G	6: 9,247,497	N156S	probably damaging	Het
Odf3l1	T	A	9: 56,849,978	M139L	possibly damaging	Het
Olfr1307	T	A	2: 111,945,156	Q100L	probably damaging	Het
Olfr1395	T	A	11: 49,149,185	C309*	probably null	Het
Pafah1b3	T	A	7: 25,295,232	I186L	probably benign	Het
Papola	C	A	12: 105,809,531	N235K	possibly damaging	Het
Pcnx3	A	T	19: 5,687,499	M98K	probably benign	Het
Pkhd1l1	A	G	15: 44,467,404	N125S	probably damaging	Het
Pls1	T	A	9: 95,773,559	H380L	probably benign	Het
Plxna1	T	C	6: 89,323,329	T1591A	possibly damaging	Het
Pparg	T	G	6: 115,441,620	S147A	probably benign	Het
Prdm10	T	C	9: 31,367,707	S1025P	probably benign	Het
Prkcd	T	A	14: 30,599,707	H510L	probably damaging	Het
Ptprh	T	A	7: 4,569,481	E499D	possibly damaging	Het
Rad51ap1	A	G	6: 126,925,020	S256P	probably benign	Het
Rad54b	A	G	4: 11,599,755	T320A	probably damaging	Het
Rnf207	A	G	4: 152,312,177	I459T	probably benign	Het
Runx2	G	A	17: 44,814,192	P80L	probably damaging	Het
Ryr3	A	T	2: 112,900,843	D727E	probably damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Slc7a11	A	G	3: 50,443,231	S11P	probably benign	Het
Sox4	A	G	13: 28,953,017	V2A	probably damaging	Het
Srf	A	G	17: 46,555,392	F146S	probably damaging	Het
Srrm2	T	C	17: 23,816,773	V797A	unknown	Het
Stk32c	T	C	7: 139,104,302	D463G	possibly damaging	Het
Syne2	C	A	12: 75,971,880	Y3384*	probably null	Het
Tmem55b	A	C	14: 50,930,177	M104R	possibly damaging	Het
Traip	T	A	9: 107,960,985	M139K	possibly damaging	Het
Trappc2l	T	A	8: 122,614,312	F100Y	probably damaging	Het
Ush1c	T	C	7: 46,229,219	D124G	probably damaging	Het
Uty	A	G	Y: 1,099,691	V1168A	probably benign	Het
Vmn2r25	T	C	6: 123,839,923	D233G	possibly damaging	Het
Zdbf2	C	T	1: 63,294,961	R31C	possibly damaging	Het

Other mutations in Mpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Mpl	APN	4	118455661	missense	possibly damaging	0.94
IGL02096:Mpl	APN	4	118457136	missense	possibly damaging	0.46
IGL02681:Mpl	APN	4	118448871	splice site	probably benign
R0238:Mpl	UTSW	4	118456863	splice site	probably benign
R0309:Mpl	UTSW	4	118446038	intron	probably benign
R0539:Mpl	UTSW	4	118443508	missense	possibly damaging	0.68
R0558:Mpl	UTSW	4	118444020	missense	probably damaging	0.99
R0601:Mpl	UTSW	4	118443536	missense	probably benign	0.08
R0784:Mpl	UTSW	4	118446406	missense	possibly damaging	0.59
R1016:Mpl	UTSW	4	118448913	missense	probably damaging	1.00
R1532:Mpl	UTSW	4	118448568	missense	possibly damaging	0.63
R1590:Mpl	UTSW	4	118444024	missense	probably damaging	0.99
R1806:Mpl	UTSW	4	118443532	missense	possibly damaging	0.73
R1875:Mpl	UTSW	4	118456829	missense	probably benign
R1935:Mpl	UTSW	4	118455739	missense	probably benign	0.01
R2182:Mpl	UTSW	4	118457413	missense	probably benign
R2291:Mpl	UTSW	4	118449000	missense	probably benign	0.04
R2508:Mpl	UTSW	4	118455757	missense	probably damaging	1.00
R4242:Mpl	UTSW	4	118456771	missense	probably damaging	0.98
R4718:Mpl	UTSW	4	118456724	missense	probably benign	0.02
R4775:Mpl	UTSW	4	118448580	missense	probably damaging	1.00
R5158:Mpl	UTSW	4	118456684	missense	probably damaging	0.98
R5208:Mpl	UTSW	4	118455881	missense	probably benign	0.00
R5276:Mpl	UTSW	4	118455721	missense	probably benign
R5953:Mpl	UTSW	4	118454510	missense	possibly damaging	0.89
R5953:Mpl	UTSW	4	118454511	missense	probably damaging	0.99
R6439:Mpl	UTSW	4	118448553	missense	probably damaging	0.98
R6450:Mpl	UTSW	4	118448700	splice site	probably null
R6521:Mpl	UTSW	4	118455117	critical splice donor site	probably null
R6812:Mpl	UTSW	4	118455264	missense	probably benign	0.03
R6876:Mpl	UTSW	4	118457120	missense	probably damaging	1.00
R7095:Mpl	UTSW	4	118444063	missense
R7100:Mpl	UTSW	4	118457410	missense
R7173:Mpl	UTSW	4	118448544	critical splice donor site	probably null
R7512:Mpl	UTSW	4	118448892	missense

Predicted Primers

PCR Primer
(F):5'- AGTGCCATGCCTCTGAGATC -3'
(R):5'- TCTGACATTTCTGACCCATGG -3'

Sequencing Primer
(F):5'- CTCTGAGATCCAGGGGAGAG -3'
(R):5'- GCCTAATTCACTGTGGTGCATAAC -3'

Posted On

2019-06-26