Incidental Mutation 'R7177:Mpl'
ID558668
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Namemyeloproliferative leukemia virus oncogene
SynonymsTPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118442415-118457513 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 118448544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000102671] [ENSMUST00000106375] [ENSMUST00000106375]
Predicted Effect probably null
Transcript: ENSMUST00000006556
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006556
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102671
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102671
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106375
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106375
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0601:Mpl UTSW 4 118443536 missense probably benign 0.08
R0784:Mpl UTSW 4 118446406 missense possibly damaging 0.59
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1806:Mpl UTSW 4 118443532 missense possibly damaging 0.73
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5158:Mpl UTSW 4 118456684 missense probably damaging 0.98
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6450:Mpl UTSW 4 118448700 splice site probably null
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
R7095:Mpl UTSW 4 118444063 missense
R7100:Mpl UTSW 4 118457410 missense
R7173:Mpl UTSW 4 118448544 critical splice donor site probably null
R7512:Mpl UTSW 4 118448892 missense
Predicted Primers PCR Primer
(F):5'- AGTGCCATGCCTCTGAGATC -3'
(R):5'- TCTGACATTTCTGACCCATGG -3'

Sequencing Primer
(F):5'- CTCTGAGATCCAGGGGAGAG -3'
(R):5'- GCCTAATTCACTGTGGTGCATAAC -3'
Posted On2019-06-26