Incidental Mutation 'R7177:Rnf207'
ID 558671
Institutional Source Beutler Lab
Gene Symbol Rnf207
Ensembl Gene ENSMUSG00000058498
Gene Name ring finger protein 207
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R7177 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 152307019-152318993 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152312177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 459 (I459T)
Ref Sequence ENSEMBL: ENSMUSP00000075540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076183] [ENSMUST00000130008] [ENSMUST00000170820]
AlphaFold Q3V3A7
Predicted Effect probably benign
Transcript: ENSMUST00000076183
AA Change: I459T

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075540
Gene: ENSMUSG00000058498
AA Change: I459T

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 3.6e-11 PFAM
Pfam:DUF3583 204 378 1.2e-10 PFAM
coiled coil region 422 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130008
SMART Domains Protein: ENSMUSP00000127196
Gene: ENSMUSG00000058498

DomainStartEndE-ValueType
RING 25 63 5.6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170820
AA Change: I424T

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129400
Gene: ENSMUSG00000058498
AA Change: I424T

DomainStartEndE-ValueType
RING 25 63 1.16e-5 SMART
Pfam:zf-B_box 93 145 1e-11 PFAM
low complexity region 236 242 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 387 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Rnf207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Rnf207 APN 4 152318261 splice site probably benign
IGL02325:Rnf207 APN 4 152311780 missense probably damaging 0.97
IGL02451:Rnf207 APN 4 152312412 missense probably benign 0.25
felonius UTSW 4 152311780 missense probably damaging 0.98
perjury UTSW 4 152313215 missense probably benign 0.00
R0311:Rnf207 UTSW 4 152315779 missense probably damaging 1.00
R0462:Rnf207 UTSW 4 152313372 missense possibly damaging 0.78
R0671:Rnf207 UTSW 4 152307468 missense probably benign 0.00
R0845:Rnf207 UTSW 4 152312064 splice site probably benign
R1544:Rnf207 UTSW 4 152313871 splice site probably benign
R1667:Rnf207 UTSW 4 152313215 missense probably benign 0.00
R4052:Rnf207 UTSW 4 152311437 missense probably benign 0.41
R4335:Rnf207 UTSW 4 152315605 splice site probably benign
R4649:Rnf207 UTSW 4 152312155 missense probably benign 0.06
R5033:Rnf207 UTSW 4 152313209 missense probably benign 0.00
R5268:Rnf207 UTSW 4 152313889 missense probably damaging 1.00
R5603:Rnf207 UTSW 4 152312394 missense probably damaging 1.00
R5938:Rnf207 UTSW 4 152317928 intron probably benign
R6147:Rnf207 UTSW 4 152315655 missense probably damaging 1.00
R6181:Rnf207 UTSW 4 152308848 missense probably benign 0.00
R6866:Rnf207 UTSW 4 152312532 missense possibly damaging 0.81
R7166:Rnf207 UTSW 4 152311780 missense probably damaging 0.98
R7354:Rnf207 UTSW 4 152314091 missense probably damaging 0.96
R7893:Rnf207 UTSW 4 152311438 missense probably damaging 0.99
R8200:Rnf207 UTSW 4 152314035 critical splice donor site probably null
R8789:Rnf207 UTSW 4 152307467 missense probably benign 0.04
X0026:Rnf207 UTSW 4 152316042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCTGGCAAGGTACCATAC -3'
(R):5'- AGGATTCCTATCGGGTGAGG -3'

Sequencing Primer
(F):5'- ATACCAGGTACTCTCCCCG -3'
(R):5'- AGGCAGGGTTGTGAGGCC -3'
Posted On 2019-06-26