Incidental Mutation 'R7177:Cracr2a'
ID558679
Institutional Source Beutler Lab
Gene Symbol Cracr2a
Ensembl Gene ENSMUSG00000061414
Gene Namecalcium release activated channel regulator 2A
SynonymsLOC243645, Efcab4b, LOC381812
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location127561338-127674248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127608706 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 156 (M156L)
Ref Sequence ENSEMBL: ENSMUSP00000071494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]
Predicted Effect probably benign
Transcript: ENSMUST00000071563
AA Change: M156L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: M156L

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212051
AA Change: M156L

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Cracr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Cracr2a APN 6 127629930 intron probably benign
PIT4812001:Cracr2a UTSW 6 127625870 missense probably damaging 1.00
R0111:Cracr2a UTSW 6 127604061 missense probably benign 0.00
R0180:Cracr2a UTSW 6 127604074 critical splice donor site probably null
R1612:Cracr2a UTSW 6 127603929 nonsense probably null
R1929:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2055:Cracr2a UTSW 6 127608601 nonsense probably null
R2270:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2272:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2915:Cracr2a UTSW 6 127611505 missense probably damaging 0.98
R4476:Cracr2a UTSW 6 127629819 missense probably benign 0.18
R4600:Cracr2a UTSW 6 127603888 missense probably benign 0.00
R4767:Cracr2a UTSW 6 127611507 missense probably damaging 0.98
R5256:Cracr2a UTSW 6 127604029 missense probably damaging 1.00
R5657:Cracr2a UTSW 6 127604007 missense probably damaging 1.00
R5729:Cracr2a UTSW 6 127607236 missense possibly damaging 0.88
R6437:Cracr2a UTSW 6 127631831 missense probably damaging 0.96
R6572:Cracr2a UTSW 6 127608752 splice site probably null
R6851:Cracr2a UTSW 6 127608716 missense probably damaging 1.00
R7616:Cracr2a UTSW 6 127608697 nonsense probably null
R7809:Cracr2a UTSW 6 127649962 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCCCTGAGACAGCGGAAG -3'
(R):5'- TCCAAGCTGCCTCCAATGAG -3'

Sequencing Primer
(F):5'- AAGCCAAGTCCTCCCTGG -3'
(R):5'- CTCCAATGAGGGGCATCC -3'
Posted On2019-06-26