Incidental Mutation 'R0589:Grk3'
ID55868
Institutional Source Beutler Lab
Gene Symbol Grk3
Ensembl Gene ENSMUSG00000042249
Gene NameG protein-coupled receptor kinase 3
Synonyms4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0589 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location112910482-113015791 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 112928763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197888] [ENSMUST00000200332]
Predicted Effect probably benign
Transcript: ENSMUST00000065167
SMART Domains Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
RGS 54 175 1.44e-28 SMART
S_TKc 191 453 8.94e-85 SMART
S_TK_X 454 530 2.19e-10 SMART
PH 559 654 8.45e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195928
Predicted Effect probably benign
Transcript: ENSMUST00000197888
SMART Domains Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
RGS 12 133 1.44e-28 SMART
S_TKc 149 411 8.94e-85 SMART
S_TK_X 412 488 2.19e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199337
Predicted Effect probably benign
Transcript: ENSMUST00000200332
SMART Domains Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

DomainStartEndE-ValueType
PDB:3V5W|A 1 88 6e-42 PDB
SCOP:d1dk8a_ 48 88 2e-4 SMART
Blast:RGS 54 88 1e-18 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
Olfr531 T G 7: 140,400,900 S49R possibly damaging Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Grk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Grk3 APN 5 112985819 missense probably damaging 1.00
IGL01359:Grk3 APN 5 112937760 missense probably damaging 1.00
IGL02318:Grk3 APN 5 112937803 missense probably damaging 1.00
IGL02612:Grk3 APN 5 112969234 missense probably benign 0.27
R0142:Grk3 UTSW 5 112915053 missense probably damaging 1.00
R0607:Grk3 UTSW 5 112920053 missense probably damaging 1.00
R1459:Grk3 UTSW 5 112915012 missense probably benign 0.10
R1554:Grk3 UTSW 5 112969269 missense possibly damaging 0.76
R1640:Grk3 UTSW 5 113015382 missense probably benign 0.36
R1657:Grk3 UTSW 5 112966982 missense probably damaging 1.00
R1789:Grk3 UTSW 5 112941718 missense probably damaging 1.00
R2401:Grk3 UTSW 5 112914983 missense probably benign
R3735:Grk3 UTSW 5 112953831 missense probably benign 0.00
R4024:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4025:Grk3 UTSW 5 112914984 missense possibly damaging 0.77
R4392:Grk3 UTSW 5 112920136 missense probably damaging 1.00
R4439:Grk3 UTSW 5 112946677 splice site probably null
R4589:Grk3 UTSW 5 112941718 missense possibly damaging 0.87
R4646:Grk3 UTSW 5 112929720 missense probably benign 0.04
R5154:Grk3 UTSW 5 112941717 missense probably damaging 1.00
R5462:Grk3 UTSW 5 112969208 missense probably damaging 1.00
R5764:Grk3 UTSW 5 112966910 critical splice donor site probably null
R5790:Grk3 UTSW 5 112966976 missense possibly damaging 0.80
R6516:Grk3 UTSW 5 112961549 intron probably benign
R6848:Grk3 UTSW 5 112985775 missense probably damaging 0.98
R7857:Grk3 UTSW 5 112961561 missense unknown
R7873:Grk3 UTSW 5 112929686 missense probably benign 0.03
R7940:Grk3 UTSW 5 112961561 missense unknown
R7956:Grk3 UTSW 5 112929686 missense probably benign 0.03
R8029:Grk3 UTSW 5 112961642 missense probably benign
RF021:Grk3 UTSW 5 112941688 missense probably benign 0.20
Z1176:Grk3 UTSW 5 112957314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCCCTGTACTTTGACTCCAGAC -3'
(R):5'- AGGCTCTTTAGACCTGCCAAAACC -3'

Sequencing Primer
(F):5'- ATGAGGGCTCCTAGTGACG -3'
(R):5'- TTTAGACCTGCCAAAACCAATCAG -3'
Posted On2013-07-11