Incidental Mutation 'R7177:Ptprh'
ID558680
Institutional Source Beutler Lab
Gene Symbol Ptprh
Ensembl Gene ENSMUSG00000035429
Gene Nameprotein tyrosine phosphatase, receptor type, H
SynonymsSAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4548612-4604041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4569481 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 499 (E499D)
Ref Sequence ENSEMBL: ENSMUSP00000042396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049113] [ENSMUST00000166650] [ENSMUST00000206999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049113
AA Change: E499D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042396
Gene: ENSMUSG00000035429
AA Change: E499D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166650
AA Change: E499D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125833
Gene: ENSMUSG00000035429
AA Change: E499D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN3 67 145 2.42e-9 SMART
FN3 156 234 9.69e-9 SMART
FN3 245 323 1.57e-8 SMART
FN3 334 412 6.29e-8 SMART
FN3 427 505 7.75e-8 SMART
FN3 516 593 1.21e0 SMART
transmembrane domain 605 627 N/A INTRINSIC
PTPc 670 932 1.09e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000206999
AA Change: E499D

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. The extracellular region contains eight fibronectin type III-like repeats and multiple N-glycosylation sites. The gene was shown to be expressed primarily in brain and liver, and at a lower level in heart and stomach. It was also found to be expressed in several cancer cell lines, but not in the corresponding normal tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null alllele exhibit normal intestinal epithelial cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Ptprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Ptprh APN 7 4580916 missense probably benign 0.23
IGL02420:Ptprh APN 7 4580930 missense probably damaging 1.00
IGL02619:Ptprh APN 7 4549499 missense probably damaging 1.00
IGL02729:Ptprh APN 7 4580874 missense probably damaging 0.99
BB008:Ptprh UTSW 7 4571988 missense probably benign 0.03
BB018:Ptprh UTSW 7 4571988 missense probably benign 0.03
R0018:Ptprh UTSW 7 4601846 critical splice donor site probably null
R0049:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R0449:Ptprh UTSW 7 4598006 missense probably damaging 1.00
R0477:Ptprh UTSW 7 4597998 missense possibly damaging 0.87
R0626:Ptprh UTSW 7 4564272 missense probably benign 0.00
R0741:Ptprh UTSW 7 4554173 critical splice donor site probably null
R1068:Ptprh UTSW 7 4549463 missense possibly damaging 0.89
R1226:Ptprh UTSW 7 4603092 nonsense probably null
R1487:Ptprh UTSW 7 4552738 missense probably damaging 1.00
R1495:Ptprh UTSW 7 4580889 missense probably benign 0.02
R1537:Ptprh UTSW 7 4549699 missense probably damaging 1.00
R1601:Ptprh UTSW 7 4552638 missense probably damaging 1.00
R1731:Ptprh UTSW 7 4601913 missense probably benign 0.00
R1920:Ptprh UTSW 7 4549395 missense probably benign 0.25
R2082:Ptprh UTSW 7 4550775 missense probably damaging 1.00
R2180:Ptprh UTSW 7 4601868 missense probably benign 0.26
R2214:Ptprh UTSW 7 4552922 missense possibly damaging 0.78
R2245:Ptprh UTSW 7 4573346 missense probably benign 0.09
R2271:Ptprh UTSW 7 4603133 start gained probably benign
R3693:Ptprh UTSW 7 4554235 missense probably damaging 0.99
R3713:Ptprh UTSW 7 4571970 missense probably damaging 1.00
R4081:Ptprh UTSW 7 4580988 missense probably damaging 0.99
R4205:Ptprh UTSW 7 4597992 missense probably damaging 1.00
R4689:Ptprh UTSW 7 4597997 missense possibly damaging 0.74
R4782:Ptprh UTSW 7 4569577 missense probably benign 0.08
R4838:Ptprh UTSW 7 4573430 missense possibly damaging 0.78
R4974:Ptprh UTSW 7 4551007 splice site probably null
R5218:Ptprh UTSW 7 4597920 missense probably benign 0.05
R5430:Ptprh UTSW 7 4551047 missense probably damaging 1.00
R5533:Ptprh UTSW 7 4549505 missense probably damaging 1.00
R5544:Ptprh UTSW 7 4580910 nonsense probably null
R5547:Ptprh UTSW 7 4554222 nonsense probably null
R5869:Ptprh UTSW 7 4601940 missense probably benign 0.00
R5928:Ptprh UTSW 7 4573508 missense probably damaging 1.00
R6063:Ptprh UTSW 7 4573362 missense possibly damaging 0.80
R6112:Ptprh UTSW 7 4597923 missense probably benign 0.01
R6493:Ptprh UTSW 7 4580990 missense possibly damaging 0.65
R6733:Ptprh UTSW 7 4603044 splice site probably null
R6836:Ptprh UTSW 7 4551135 missense probably damaging 1.00
R6859:Ptprh UTSW 7 4549371 nonsense probably null
R6868:Ptprh UTSW 7 4601865 missense probably benign
R7015:Ptprh UTSW 7 4552627 critical splice donor site probably null
R7092:Ptprh UTSW 7 4580861 critical splice donor site probably null
R7147:Ptprh UTSW 7 4550782 missense probably damaging 1.00
R7358:Ptprh UTSW 7 4551007 splice site probably null
R7436:Ptprh UTSW 7 4552743 missense probably damaging 1.00
R7512:Ptprh UTSW 7 4571781 missense possibly damaging 0.60
R7863:Ptprh UTSW 7 4603098 start codon destroyed probably benign 0.31
R7931:Ptprh UTSW 7 4571988 missense probably benign 0.03
R7973:Ptprh UTSW 7 4580888 missense possibly damaging 0.55
R8239:Ptprh UTSW 7 4581091 missense probably damaging 1.00
R8331:Ptprh UTSW 7 4549481 missense probably damaging 1.00
RF022:Ptprh UTSW 7 4549368 missense probably benign
Z1177:Ptprh UTSW 7 4597971 missense probably damaging 0.99
Z1177:Ptprh UTSW 7 4598118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTATATCAATCTCTCTGGGTGTG -3'
(R):5'- TTTCAGCCTCAAACCCAGTGAG -3'

Sequencing Primer
(F):5'- ATCAATCTCTCTGGGTGTGTAATTTC -3'
(R):5'- GGTCGAAGGTCAGAACAACTTCTC -3'
Posted On2019-06-26