Incidental Mutation 'R7177:Prdm10'
Institutional Source Beutler Lab
Gene Symbol Prdm10
Ensembl Gene ENSMUSG00000042496
Gene NamePR domain containing 10
Synonymstristanin, LOC382066
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location31280538-31381723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31367707 bp
Amino Acid Change Serine to Proline at position 1025 (S1025P)
Ref Sequence ENSEMBL: ENSMUSP00000074104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000215499] [ENSMUST00000215847]
Predicted Effect probably benign
Transcript: ENSMUST00000074510
AA Change: S1025P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: S1025P

signal peptide 1 22 N/A INTRINSIC
low complexity region 111 117 N/A INTRINSIC
PDB:3IHX|D 133 284 1e-104 PDB
Blast:SET 165 277 3e-32 BLAST
ZnF_C2H2 300 322 5.42e-2 SMART
Pfam:Tristanin_u2 325 455 2.4e-49 PFAM
ZnF_C2H2 471 493 7.78e-3 SMART
ZnF_C2H2 501 523 1.95e-3 SMART
ZnF_C2H2 529 551 3.83e-2 SMART
ZnF_C2H2 557 580 8.34e-3 SMART
ZnF_C2H2 585 607 3.21e-4 SMART
ZnF_C2H2 613 636 3.69e-4 SMART
ZnF_C2H2 668 691 8.22e-2 SMART
ZnF_C2H2 801 824 1.25e-1 SMART
low complexity region 904 916 N/A INTRINSIC
low complexity region 956 964 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1110 1122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215499
Predicted Effect probably benign
Transcript: ENSMUST00000215847
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Prdm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Prdm10 APN 9 31360812 splice site probably benign
IGL00485:Prdm10 APN 9 31327546 missense possibly damaging 0.87
IGL00757:Prdm10 APN 9 31318546 missense possibly damaging 0.69
IGL00836:Prdm10 APN 9 31329869 splice site probably benign
IGL01505:Prdm10 APN 9 31327282 missense probably benign
IGL01594:Prdm10 APN 9 31346853 missense probably damaging 1.00
IGL01894:Prdm10 APN 9 31316261 missense probably damaging 1.00
IGL01927:Prdm10 APN 9 31335398 splice site probably benign
IGL02053:Prdm10 APN 9 31360848 missense probably benign 0.00
IGL02068:Prdm10 APN 9 31337350 missense probably damaging 1.00
IGL02295:Prdm10 APN 9 31362368 missense probably benign
IGL02390:Prdm10 APN 9 31353389 missense possibly damaging 0.68
IGL02574:Prdm10 APN 9 31357293 missense probably damaging 1.00
IGL02636:Prdm10 APN 9 31329681 missense possibly damaging 0.68
IGL02883:Prdm10 APN 9 31327348 missense probably damaging 0.99
IGL03057:Prdm10 APN 9 31349185 missense probably damaging 1.00
PIT4142001:Prdm10 UTSW 9 31325767 missense probably benign 0.00
R0089:Prdm10 UTSW 9 31316230 missense probably damaging 1.00
R0149:Prdm10 UTSW 9 31316159 splice site probably benign
R0306:Prdm10 UTSW 9 31316224 missense probably damaging 1.00
R0386:Prdm10 UTSW 9 31316300 missense probably damaging 1.00
R0390:Prdm10 UTSW 9 31349268 critical splice donor site probably null
R1512:Prdm10 UTSW 9 31337401 missense probably damaging 1.00
R1528:Prdm10 UTSW 9 31357286 missense probably damaging 1.00
R2409:Prdm10 UTSW 9 31349122 missense possibly damaging 0.81
R3745:Prdm10 UTSW 9 31340407 missense possibly damaging 0.72
R3929:Prdm10 UTSW 9 31347136 missense probably damaging 1.00
R4295:Prdm10 UTSW 9 31316294 missense possibly damaging 0.94
R4629:Prdm10 UTSW 9 31337316 nonsense probably null
R4660:Prdm10 UTSW 9 31327328 missense probably damaging 1.00
R4758:Prdm10 UTSW 9 31362412 missense probably benign 0.00
R4793:Prdm10 UTSW 9 31353405 missense probably damaging 1.00
R4798:Prdm10 UTSW 9 31341273 missense probably damaging 1.00
R4806:Prdm10 UTSW 9 31329941 makesense probably null
R4865:Prdm10 UTSW 9 31347080 missense probably damaging 1.00
R5068:Prdm10 UTSW 9 31359047 missense probably damaging 0.96
R5093:Prdm10 UTSW 9 31341483 missense probably damaging 1.00
R5162:Prdm10 UTSW 9 31340418 missense possibly damaging 0.90
R5656:Prdm10 UTSW 9 31353417 missense probably benign 0.08
R5855:Prdm10 UTSW 9 31337323 missense probably damaging 1.00
R6242:Prdm10 UTSW 9 31341252 missense possibly damaging 0.67
R6396:Prdm10 UTSW 9 31318546 missense possibly damaging 0.69
R6970:Prdm10 UTSW 9 31329823 nonsense probably null
R7165:Prdm10 UTSW 9 31316442 splice site probably null
R7201:Prdm10 UTSW 9 31316306 missense possibly damaging 0.87
R7313:Prdm10 UTSW 9 31357160 nonsense probably null
R7337:Prdm10 UTSW 9 31316241 missense probably damaging 1.00
R7511:Prdm10 UTSW 9 31378481 missense probably damaging 1.00
R7711:Prdm10 UTSW 9 31357232 missense probably damaging 1.00
R7855:Prdm10 UTSW 9 31327474 missense probably benign 0.04
R7965:Prdm10 UTSW 9 31347006 missense probably damaging 1.00
R7997:Prdm10 UTSW 9 31353425 missense probably damaging 1.00
R8168:Prdm10 UTSW 9 31346967 missense probably benign 0.00
RF004:Prdm10 UTSW 9 31359126 missense probably damaging 1.00
X0064:Prdm10 UTSW 9 31362451 missense probably damaging 1.00
Z1176:Prdm10 UTSW 9 31316168 missense possibly damaging 0.95
Z1176:Prdm10 UTSW 9 31316293 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ctctgatcgtctgagaaagg -3'
Posted On2019-06-26