Incidental Mutation 'R0589:Olfr531'
ID55872
Institutional Source Beutler Lab
Gene Symbol Olfr531
Ensembl Gene ENSMUSG00000062712
Gene Nameolfactory receptor 531
SynonymsGA_x6K02T2PBJ9-42551260-42550346, MOR251-3
MMRRC Submission 038779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0589 (G1)
Quality Score198
Status Validated
Chromosome7
Chromosomal Location140399045-140402918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 140400900 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 49 (S49R)
Ref Sequence ENSEMBL: ENSMUSP00000149942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080153] [ENSMUST00000216053] [ENSMUST00000217167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080153
AA Change: S49R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079048
Gene: ENSMUSG00000062712
AA Change: S49R

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 6.3e-46 PFAM
Pfam:7tm_1 38 286 1.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216053
AA Change: S49R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217032
Predicted Effect possibly damaging
Transcript: ENSMUST00000217167
AA Change: S49R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,942,268 A1202E probably damaging Het
Abcc12 A T 8: 86,560,472 I155N possibly damaging Het
Atf4 T A 15: 80,256,439 H47Q probably damaging Het
Atm T A 9: 53,490,192 D1459V possibly damaging Het
Bicral A G 17: 46,801,596 S893P probably benign Het
Camk2a G A 18: 60,963,964 probably null Het
Cebpz G A 17: 78,936,879 T51I probably damaging Het
Cers5 A T 15: 99,740,956 D208E probably damaging Het
Cyp1a2 T C 9: 57,679,062 D391G possibly damaging Het
Dct G T 14: 118,043,270 F111L probably benign Het
Ddb1 T G 19: 10,621,716 I529S probably benign Het
Dhx9 G T 1: 153,472,291 Q361K probably damaging Het
Erbin G T 13: 103,886,287 R15S probably damaging Het
F13b T C 1: 139,506,933 S146P possibly damaging Het
Fam166b T C 4: 43,427,355 probably benign Het
Fam208a T C 14: 27,461,150 I522T probably benign Het
Ggnbp2 A T 11: 84,836,451 C520S probably damaging Het
Gpx3 A G 11: 54,909,503 I208V probably benign Het
Grk3 A G 5: 112,928,763 probably benign Het
Heatr9 T C 11: 83,514,690 probably benign Het
Heg1 T G 16: 33,731,707 I762R probably damaging Het
Ints11 A T 4: 155,886,886 T264S probably damaging Het
Ints14 T C 9: 64,979,831 L348P probably damaging Het
Marf1 C A 16: 14,142,055 probably benign Het
Med13 A G 11: 86,283,249 Y1808H probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrpl45 A T 11: 97,323,888 T134S probably benign Het
Myh8 A G 11: 67,298,627 I1210V probably benign Het
Nsd3 T C 8: 25,641,287 S223P probably damaging Het
Olfr1105 A T 2: 87,034,115 Y35* probably null Het
Olfr1220 A G 2: 89,097,262 F222L probably benign Het
P3h3 T A 6: 124,841,681 E731D probably damaging Het
Pcdhac2 A G 18: 37,146,474 R836G probably benign Het
Pdzd2 A G 15: 12,376,299 V1250A probably benign Het
Pgbd1 G A 13: 21,434,430 T19I possibly damaging Het
Phtf2 T A 5: 20,813,251 R31* probably null Het
Plod2 T A 9: 92,593,746 V294D probably benign Het
Rassf5 C T 1: 131,244,983 G50R probably damaging Het
Rexo5 A G 7: 119,845,383 T694A probably benign Het
Rtcb A C 10: 85,951,451 S82A probably damaging Het
Rufy4 T C 1: 74,132,883 L255P probably damaging Het
Slc35c1 A G 2: 92,454,514 F252L probably damaging Het
Slco6d1 A T 1: 98,499,747 probably benign Het
Sox10 T G 15: 79,163,285 probably benign Het
Stard9 A G 2: 120,698,547 M1762V probably benign Het
Stat3 A T 11: 100,908,083 Y94N probably damaging Het
Tecta T A 9: 42,345,634 Y1582F probably benign Het
Tex44 A G 1: 86,427,731 D454G probably damaging Het
Tle6 A G 10: 81,595,419 probably benign Het
Tmem57 C A 4: 134,828,217 C315F probably benign Het
Tmod2 T C 9: 75,576,759 E303G probably damaging Het
Trem1 A G 17: 48,237,217 D90G possibly damaging Het
Trhde A T 10: 114,448,324 D751E probably benign Het
Ttn A T 2: 76,965,245 probably null Het
Vars2 T C 17: 35,659,176 T774A probably benign Het
Wdr63 A G 3: 146,062,331 S592P probably benign Het
Other mutations in Olfr531
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Olfr531 APN 7 140400657 missense probably benign
IGL02190:Olfr531 APN 7 140400120 utr 3 prime probably benign
IGL02548:Olfr531 APN 7 140400662 missense probably damaging 1.00
R0200:Olfr531 UTSW 7 140400875 missense probably damaging 1.00
R1325:Olfr531 UTSW 7 140400881 missense probably damaging 1.00
R1985:Olfr531 UTSW 7 140400800 missense possibly damaging 0.68
R4671:Olfr531 UTSW 7 140400305 missense probably damaging 1.00
R4754:Olfr531 UTSW 7 140400159 missense probably damaging 0.99
R4941:Olfr531 UTSW 7 140400879 missense probably benign 0.24
R5015:Olfr531 UTSW 7 140400170 missense probably damaging 0.99
R5070:Olfr531 UTSW 7 140400569 missense probably benign 0.00
R5244:Olfr531 UTSW 7 140400138 missense probably benign 0.00
R5883:Olfr531 UTSW 7 140400188 missense probably damaging 1.00
R6437:Olfr531 UTSW 7 140400521 missense probably damaging 1.00
R7246:Olfr531 UTSW 7 140400148 missense probably benign 0.34
R7396:Olfr531 UTSW 7 140400563 missense probably benign 0.00
R7742:Olfr531 UTSW 7 140400321 missense probably benign 0.01
R7789:Olfr531 UTSW 7 140400697 nonsense probably null
R7799:Olfr531 UTSW 7 140400464 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCACAAAGCGGTCATAGGCCATAG -3'
(R):5'- ACTGGAACTGGAGCATGTCTTTCAC -3'

Sequencing Primer
(F):5'- CGGTCATAGGCCATAGCTGAG -3'
(R):5'- CAGATCCTATCAGAGCTGTTACAGG -3'
Posted On2013-07-11