Mutagenetix > Incidental Mutations

Incidental Mutation 'R7177:Runx2'

558727

Institutional Source

Beutler Lab

Gene Symbol

Runx2

Ensembl Gene

ENSMUSG00000039153

Gene Name

runt related transcription factor 2

Synonyms

polyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7177 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

44495987-44814797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44814192 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 80 (P80L)

Ref Sequence

ENSEMBL: ENSMUSP00000123743 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050630] [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000127798] [ENSMUST00000129416] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162629]

Predicted Effect

probably benign
Transcript: ENSMUST00000050630

SMART Domains

Protein: ENSMUSP00000050783
Gene: ENSMUSG00000038954

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
Pfam:TFIID-18kDa	24	116	4.5e-38	PFAM
low complexity region	274	294	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113568
AA Change: P80L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000113571
AA Change: P12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153
AA Change: P12L

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
coiled coil region	45	89	N/A	INTRINSIC
Pfam:Runt	106	240	9.2e-83	PFAM
Pfam:RunxI	434	528	7.6e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127798

SMART Domains

Protein: ENSMUSP00000121148
Gene: ENSMUSG00000038954

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
Pfam:TFIID-18kDa	24	116	9.3e-39	PFAM
low complexity region	274	294	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129416

SMART Domains

Protein: ENSMUSP00000120197
Gene: ENSMUSG00000038954

Domain	Start	End	E-Value	Type
Pfam:TFIID-18kDa	17	109	1e-38	PFAM
low complexity region	267	287	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130623

Predicted Effect

probably damaging
Transcript: ENSMUST00000159943
AA Change: P12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153
AA Change: P12L

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
coiled coil region	45	89	N/A	INTRINSIC
Pfam:Runt	106	240	9.2e-83	PFAM
Pfam:RunxI	434	528	7.6e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000160673
AA Change: P80L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: P80L

Domain	Start	End	E-Value	Type
low complexity region	89	101	N/A	INTRINSIC
coiled coil region	113	157	N/A	INTRINSIC
Pfam:Runt	177	306	3.9e-75	PFAM
Pfam:RunxI	505	596	3.2e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161489

Predicted Effect

probably damaging
Transcript: ENSMUST00000162629
AA Change: P12L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153
AA Change: P12L

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
coiled coil region	45	89	N/A	INTRINSIC
Pfam:Runt	106	240	3.5e-83	PFAM
Pfam:RunxI	412	506	2.7e-45	PFAM

Meta Mutation Damage Score

0.1963

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	T	A	8: 45,970,407	E89D	possibly damaging	Het
4930550C14Rik	T	C	9: 53,414,385	L74S	probably damaging	Het
4933406M09Rik	T	C	1: 134,390,425	S312P	probably benign	Het
5730409E04Rik	A	G	4: 126,611,732	S18G	probably benign	Het
Adam29	A	G	8: 55,872,624	I265T	probably benign	Het
Aff4	C	T	11: 53,406,639	S896L	probably benign	Het
Ankrd27	T	C	7: 35,619,397	I571T	probably damaging	Het
Bdp1	C	A	13: 100,049,970	R1658I	probably damaging	Het
Carm1	C	T	9: 21,547,027	T7M	unknown	Het
Ccdc105	T	C	10: 78,752,490	D162G	probably damaging	Het
Ccdc183	A	G	2: 25,616,284	V100A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Ceacam2	T	G	7: 25,520,916	D239A	probably benign	Het
Cmya5	T	C	13: 93,095,328	D1084G	probably benign	Het
Cog5	T	A	12: 31,760,889	I194K	probably damaging	Het
Col20a1	C	T	2: 180,994,214	Q211*	probably null	Het
Col9a1	T	A	1: 24,195,417	L13Q	unknown	Het
Cracr2a	A	T	6: 127,608,706	M156L	probably benign	Het
Cts8	C	T	13: 61,251,691	M151I	possibly damaging	Het
Cyp2ab1	A	T	16: 20,316,719	L11Q	probably null	Het
Dhrs13	T	A	11: 78,034,382	C160S	probably benign	Het
Enthd1	T	A	15: 80,474,214	E368D	probably damaging	Het
Fbxo18	A	G	2: 11,755,711	I676T	probably damaging	Het
Fcgrt	T	C	7: 45,101,997	R176G	probably benign	Het
Gatd1	A	G	7: 141,411,034	F67L	possibly damaging	Het
Gm4353	G	A	7: 116,084,492	P23S	probably damaging	Het
Gm6882	T	A	7: 21,427,752	I64F	possibly damaging	Het
Grwd1	A	T	7: 45,830,780	M1K	probably null	Het
Hook2	T	A	8: 84,991,417	S58T	probably benign	Het
Iqch	T	G	9: 63,421,835	*1072C	probably null	Het
Kmt2d	G	A	15: 98,850,386	T3019I	unknown	Het
Lmx1a	T	C	1: 167,846,678	S356P	probably benign	Het
Lrig3	A	G	10: 126,006,843	M546V	probably benign	Het
Lrrc1	C	A	9: 77,472,222	E96*	probably null	Het
Lrtm2	C	A	6: 119,317,152	M339I	probably damaging	Het
Map10	T	C	8: 125,671,845	V659A	probably benign	Het
Map7d1	A	G	4: 126,236,985	C384R	probably damaging	Het
Mcur1	T	C	13: 43,544,536	D296G	probably damaging	Het
Mettl24	A	T	10: 40,810,512	H295L	probably damaging	Het
Mpl	A	G	4: 118,448,544		probably null	Het
Mrps5	T	C	2: 127,595,697	V148A	probably benign	Het
N4bp2	T	C	5: 65,807,548	V980A	probably damaging	Het
Ncaph	A	T	2: 127,116,586	D504E	probably damaging	Het
Nxph1	A	G	6: 9,247,497	N156S	probably damaging	Het
Odf3l1	T	A	9: 56,849,978	M139L	possibly damaging	Het
Olfr1307	T	A	2: 111,945,156	Q100L	probably damaging	Het
Olfr1395	T	A	11: 49,149,185	C309*	probably null	Het
Pafah1b3	T	A	7: 25,295,232	I186L	probably benign	Het
Papola	C	A	12: 105,809,531	N235K	possibly damaging	Het
Pcnx3	A	T	19: 5,687,499	M98K	probably benign	Het
Pkhd1l1	A	G	15: 44,467,404	N125S	probably damaging	Het
Pls1	T	A	9: 95,773,559	H380L	probably benign	Het
Plxna1	T	C	6: 89,323,329	T1591A	possibly damaging	Het
Pparg	T	G	6: 115,441,620	S147A	probably benign	Het
Prdm10	T	C	9: 31,367,707	S1025P	probably benign	Het
Prkcd	T	A	14: 30,599,707	H510L	probably damaging	Het
Ptprh	T	A	7: 4,569,481	E499D	possibly damaging	Het
Rad51ap1	A	G	6: 126,925,020	S256P	probably benign	Het
Rad54b	A	G	4: 11,599,755	T320A	probably damaging	Het
Rnf207	A	G	4: 152,312,177	I459T	probably benign	Het
Ryr3	A	T	2: 112,900,843	D727E	probably damaging	Het
Sdk2	C	T	11: 113,829,969	R1378H	possibly damaging	Het
Slc7a11	A	G	3: 50,443,231	S11P	probably benign	Het
Sox4	A	G	13: 28,953,017	V2A	probably damaging	Het
Srf	A	G	17: 46,555,392	F146S	probably damaging	Het
Srrm2	T	C	17: 23,816,773	V797A	unknown	Het
Stk32c	T	C	7: 139,104,302	D463G	possibly damaging	Het
Syne2	C	A	12: 75,971,880	Y3384*	probably null	Het
Tmem55b	A	C	14: 50,930,177	M104R	possibly damaging	Het
Traip	T	A	9: 107,960,985	M139K	possibly damaging	Het
Trappc2l	T	A	8: 122,614,312	F100Y	probably damaging	Het
Ush1c	T	C	7: 46,229,219	D124G	probably damaging	Het
Uty	A	G	Y: 1,099,691	V1168A	probably benign	Het
Vmn2r25	T	C	6: 123,839,923	D233G	possibly damaging	Het
Zdbf2	C	T	1: 63,294,961	R31C	possibly damaging	Het

Other mutations in Runx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02020:Runx2	APN	17	44658599	missense	probably damaging	1.00
IGL02029:Runx2	APN	17	44658687	nonsense	probably null
IGL02084:Runx2	APN	17	44724829	missense	probably damaging	1.00
R0040:Runx2	UTSW	17	44608254	missense	possibly damaging	0.58
R0627:Runx2	UTSW	17	44658505	intron	probably benign
R0944:Runx2	UTSW	17	44608236	missense	probably damaging	0.99
R1514:Runx2	UTSW	17	44735337	missense	possibly damaging	0.54
R2069:Runx2	UTSW	17	44735342	missense	probably benign	0.19
R3976:Runx2	UTSW	17	44610079	missense	possibly damaging	0.91
R4686:Runx2	UTSW	17	44639685	missense	probably damaging	1.00
R4911:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R5241:Runx2	UTSW	17	44639777	nonsense	probably null
R5526:Runx2	UTSW	17	44724862	missense	probably damaging	1.00
R6566:Runx2	UTSW	17	44814488	critical splice donor site	probably null
R6874:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R6875:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R6980:Runx2	UTSW	17	44735316	missense	possibly damaging	0.65
R7008:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7009:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7057:Runx2	UTSW	17	44814537	missense	probably null
R7085:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7175:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7176:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7181:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7231:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7232:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7254:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7267:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7835:Runx2	UTSW	17	44608236	missense	probably damaging	0.99
R7949:Runx2	UTSW	17	44735555	missense	possibly damaging	0.45
R8474:Runx2	UTSW	17	44608260	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCGAGAGTTAGTTACACATGC -3'
(R):5'- CTAACCACAGTCCATGCAGG -3'

Sequencing Primer
(F):5'- GAGTTAGTTACACATGCCAAGTGC -3'
(R):5'- CCATGCAGGAATAGTAGGTCCTTC -3'

Posted On

2019-06-26