Incidental Mutation 'R7178:Speg'
ID 558733
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 045232-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7178 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75399027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2158 (V2158A)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: V2158A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: V2158A

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,535,745 (GRCm39) I130T possibly damaging Het
Adam24 T A 8: 41,133,039 (GRCm39) L169* probably null Het
Als2 A T 1: 59,246,971 (GRCm39) I556N probably damaging Het
Ankrd44 A T 1: 54,688,599 (GRCm39) N212K Het
Anpep T C 7: 79,490,736 (GRCm39) D260G probably benign Het
Arhgap17 A T 7: 122,884,581 (GRCm39) probably null Het
Atad2 C T 15: 57,980,689 (GRCm39) R383Q probably damaging Het
Atp11b T A 3: 35,874,099 (GRCm39) M696K probably benign Het
Atp13a2 A G 4: 140,726,462 (GRCm39) T350A probably damaging Het
Atp8b2 T C 3: 89,850,979 (GRCm39) D29G possibly damaging Het
Baz2a C T 10: 127,960,326 (GRCm39) R1514W probably damaging Het
Cep250 T A 2: 155,815,375 (GRCm39) L631* probably null Het
Cimip2a G A 2: 25,110,252 (GRCm39) V55I probably damaging Het
Clec4a3 T C 6: 122,941,251 (GRCm39) I82T probably benign Het
Csmd3 T A 15: 47,454,170 (GRCm39) I2648F Het
Cul5 A G 9: 53,555,826 (GRCm39) F247L probably benign Het
Dnajc24 A T 2: 105,800,807 (GRCm39) M101K probably damaging Het
Dnhd1 T A 7: 105,344,200 (GRCm39) V1848E probably damaging Het
Dspp A G 5: 104,321,932 (GRCm39) T14A probably benign Het
Gm7298 T G 6: 121,762,855 (GRCm39) I1392S probably damaging Het
Gm9955 A T 18: 24,842,220 (GRCm39) S62R unknown Het
Gtsf1 T G 15: 103,328,388 (GRCm39) N130T probably benign Het
Heatr5a C A 12: 51,971,925 (GRCm39) S755I probably damaging Het
Hrc A G 7: 44,985,685 (GRCm39) T279A possibly damaging Het
Hvcn1 T C 5: 122,371,573 (GRCm39) W38R probably damaging Het
Hyal6 A G 6: 24,734,834 (GRCm39) S256G probably benign Het
Insyn2b G T 11: 34,352,359 (GRCm39) V134F probably damaging Het
Ipo13 A G 4: 117,761,081 (GRCm39) S546P possibly damaging Het
Katnip T C 7: 125,465,499 (GRCm39) V1317A probably benign Het
Kif24 A G 4: 41,395,085 (GRCm39) V730A probably benign Het
L3mbtl2 T C 15: 81,555,275 (GRCm39) V176A probably benign Het
Lgi1 T C 19: 38,294,733 (GRCm39) Y502H probably damaging Het
Liph T A 16: 21,795,078 (GRCm39) D178V probably damaging Het
Maea T C 5: 33,515,854 (GRCm39) V47A probably damaging Het
Mak16 A C 8: 31,656,602 (GRCm39) S42A probably benign Het
Mamdc4 T C 2: 25,458,977 (GRCm39) I269V probably benign Het
Mapk8ip3 A T 17: 25,120,728 (GRCm39) M812K probably benign Het
Muc4 T A 16: 32,752,788 (GRCm38) S889T unknown Het
Npy6r A G 18: 44,409,551 (GRCm39) N324S probably damaging Het
Ntrk3 T G 7: 78,005,895 (GRCm39) T489P possibly damaging Het
Or52a5b G A 7: 103,417,182 (GRCm39) Q141* probably null Het
Or5h19 T A 16: 58,856,296 (GRCm39) D268V probably benign Het
Or5t17 G A 2: 86,832,879 (GRCm39) V189I probably benign Het
Otof G C 5: 30,540,878 (GRCm39) T887S possibly damaging Het
Papola T C 12: 105,773,443 (GRCm39) V154A probably damaging Het
Pde4dip T C 3: 97,622,946 (GRCm39) H1421R probably benign Het
Plpp5 T C 8: 26,210,606 (GRCm39) S66P probably benign Het
Ppp6r3 T A 19: 3,568,337 (GRCm39) I154L probably benign Het
Prr18 A C 17: 8,560,741 (GRCm39) D299A possibly damaging Het
Psmb1 G A 17: 15,697,521 (GRCm39) S198F possibly damaging Het
Qars1 T C 9: 108,392,322 (GRCm39) V723A possibly damaging Het
Rab6a A T 7: 100,285,959 (GRCm39) R185* probably null Het
Scn2a C T 2: 65,579,197 (GRCm39) Q1511* probably null Het
Serpinb3d T A 1: 107,008,506 (GRCm39) I120F possibly damaging Het
Serpini2 T C 3: 75,165,455 (GRCm39) T175A probably damaging Het
Skic2 T C 17: 35,058,440 (GRCm39) T1226A probably benign Het
Slc17a6 A G 7: 51,317,259 (GRCm39) I427V possibly damaging Het
Slc2a2 C T 3: 28,773,631 (GRCm39) A312V possibly damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Spcs1 G A 14: 30,722,438 (GRCm39) S127F possibly damaging Het
Sptbn4 T A 7: 27,117,481 (GRCm39) I423F probably damaging Het
Synj2 T A 17: 6,076,754 (GRCm39) I930N possibly damaging Het
Tas2r140 T A 6: 133,032,623 (GRCm39) D45V probably damaging Het
Tcf3 C A 10: 80,257,433 (GRCm39) V11F unknown Het
Tead1 A T 7: 112,441,144 (GRCm39) Q91L probably benign Het
Tgm5 T A 2: 120,916,249 (GRCm39) probably benign Het
Tgoln1 C T 6: 72,593,028 (GRCm39) G151S probably benign Het
Tnfrsf11a C A 1: 105,755,264 (GRCm39) N445K probably benign Het
Ttn G C 2: 76,540,514 (GRCm39) F34157L probably benign Het
Vmn2r91 C A 17: 18,356,424 (GRCm39) P697Q probably damaging Het
Zeb2 G A 2: 44,887,006 (GRCm39) L684F probably damaging Het
Zfp661 T C 2: 127,419,456 (GRCm39) D228G probably benign Het
Zfp738 T C 13: 67,821,147 (GRCm39) K77E probably damaging Het
Zkscan1 T A 5: 138,099,192 (GRCm39) D378E probably damaging Het
Zswim9 T A 7: 12,993,924 (GRCm39) D744V possibly damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0483:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R1936:Speg UTSW 1 75,408,052 (GRCm39) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R3983:Speg UTSW 1 75,399,191 (GRCm39) missense probably benign 0.27
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4858:Speg UTSW 1 75,398,379 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8085:Speg UTSW 1 75,391,997 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R8935:Speg UTSW 1 75,399,250 (GRCm39) missense probably benign 0.30
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAAGGACTCCCTCTAAGG -3'
(R):5'- TCAGGGACCTTTTCTGGGAC -3'

Sequencing Primer
(F):5'- TAGCTCTGCTGAGAGTGCC -3'
(R):5'- TGGGACAGGCTGAGGTTCC -3'
Posted On 2019-06-26