Incidental Mutation 'R7178:Scn2a'
ID 558739
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 045232-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7178 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 65579197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1511 (Q1511*)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably null
Transcript: ENSMUST00000028377
AA Change: Q1511*
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: Q1511*

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100067
AA Change: Q1511*
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: Q1511*

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200829
AA Change: Q1511*
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: Q1511*

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,535,745 (GRCm39) I130T possibly damaging Het
Adam24 T A 8: 41,133,039 (GRCm39) L169* probably null Het
Als2 A T 1: 59,246,971 (GRCm39) I556N probably damaging Het
Ankrd44 A T 1: 54,688,599 (GRCm39) N212K Het
Anpep T C 7: 79,490,736 (GRCm39) D260G probably benign Het
Arhgap17 A T 7: 122,884,581 (GRCm39) probably null Het
Atad2 C T 15: 57,980,689 (GRCm39) R383Q probably damaging Het
Atp11b T A 3: 35,874,099 (GRCm39) M696K probably benign Het
Atp13a2 A G 4: 140,726,462 (GRCm39) T350A probably damaging Het
Atp8b2 T C 3: 89,850,979 (GRCm39) D29G possibly damaging Het
Baz2a C T 10: 127,960,326 (GRCm39) R1514W probably damaging Het
Cep250 T A 2: 155,815,375 (GRCm39) L631* probably null Het
Cimip2a G A 2: 25,110,252 (GRCm39) V55I probably damaging Het
Clec4a3 T C 6: 122,941,251 (GRCm39) I82T probably benign Het
Csmd3 T A 15: 47,454,170 (GRCm39) I2648F Het
Cul5 A G 9: 53,555,826 (GRCm39) F247L probably benign Het
Dnajc24 A T 2: 105,800,807 (GRCm39) M101K probably damaging Het
Dnhd1 T A 7: 105,344,200 (GRCm39) V1848E probably damaging Het
Dspp A G 5: 104,321,932 (GRCm39) T14A probably benign Het
Gm7298 T G 6: 121,762,855 (GRCm39) I1392S probably damaging Het
Gm9955 A T 18: 24,842,220 (GRCm39) S62R unknown Het
Gtsf1 T G 15: 103,328,388 (GRCm39) N130T probably benign Het
Heatr5a C A 12: 51,971,925 (GRCm39) S755I probably damaging Het
Hrc A G 7: 44,985,685 (GRCm39) T279A possibly damaging Het
Hvcn1 T C 5: 122,371,573 (GRCm39) W38R probably damaging Het
Hyal6 A G 6: 24,734,834 (GRCm39) S256G probably benign Het
Insyn2b G T 11: 34,352,359 (GRCm39) V134F probably damaging Het
Ipo13 A G 4: 117,761,081 (GRCm39) S546P possibly damaging Het
Katnip T C 7: 125,465,499 (GRCm39) V1317A probably benign Het
Kif24 A G 4: 41,395,085 (GRCm39) V730A probably benign Het
L3mbtl2 T C 15: 81,555,275 (GRCm39) V176A probably benign Het
Lgi1 T C 19: 38,294,733 (GRCm39) Y502H probably damaging Het
Liph T A 16: 21,795,078 (GRCm39) D178V probably damaging Het
Maea T C 5: 33,515,854 (GRCm39) V47A probably damaging Het
Mak16 A C 8: 31,656,602 (GRCm39) S42A probably benign Het
Mamdc4 T C 2: 25,458,977 (GRCm39) I269V probably benign Het
Mapk8ip3 A T 17: 25,120,728 (GRCm39) M812K probably benign Het
Muc4 T A 16: 32,752,788 (GRCm38) S889T unknown Het
Npy6r A G 18: 44,409,551 (GRCm39) N324S probably damaging Het
Ntrk3 T G 7: 78,005,895 (GRCm39) T489P possibly damaging Het
Or52a5b G A 7: 103,417,182 (GRCm39) Q141* probably null Het
Or5h19 T A 16: 58,856,296 (GRCm39) D268V probably benign Het
Or5t17 G A 2: 86,832,879 (GRCm39) V189I probably benign Het
Otof G C 5: 30,540,878 (GRCm39) T887S possibly damaging Het
Papola T C 12: 105,773,443 (GRCm39) V154A probably damaging Het
Pde4dip T C 3: 97,622,946 (GRCm39) H1421R probably benign Het
Plpp5 T C 8: 26,210,606 (GRCm39) S66P probably benign Het
Ppp6r3 T A 19: 3,568,337 (GRCm39) I154L probably benign Het
Prr18 A C 17: 8,560,741 (GRCm39) D299A possibly damaging Het
Psmb1 G A 17: 15,697,521 (GRCm39) S198F possibly damaging Het
Qars1 T C 9: 108,392,322 (GRCm39) V723A possibly damaging Het
Rab6a A T 7: 100,285,959 (GRCm39) R185* probably null Het
Serpinb3d T A 1: 107,008,506 (GRCm39) I120F possibly damaging Het
Serpini2 T C 3: 75,165,455 (GRCm39) T175A probably damaging Het
Skic2 T C 17: 35,058,440 (GRCm39) T1226A probably benign Het
Slc17a6 A G 7: 51,317,259 (GRCm39) I427V possibly damaging Het
Slc2a2 C T 3: 28,773,631 (GRCm39) A312V possibly damaging Het
Snx33 C T 9: 56,833,151 (GRCm39) R306H probably damaging Het
Spcs1 G A 14: 30,722,438 (GRCm39) S127F possibly damaging Het
Speg T C 1: 75,399,027 (GRCm39) V2158A possibly damaging Het
Sptbn4 T A 7: 27,117,481 (GRCm39) I423F probably damaging Het
Synj2 T A 17: 6,076,754 (GRCm39) I930N possibly damaging Het
Tas2r140 T A 6: 133,032,623 (GRCm39) D45V probably damaging Het
Tcf3 C A 10: 80,257,433 (GRCm39) V11F unknown Het
Tead1 A T 7: 112,441,144 (GRCm39) Q91L probably benign Het
Tgm5 T A 2: 120,916,249 (GRCm39) probably benign Het
Tgoln1 C T 6: 72,593,028 (GRCm39) G151S probably benign Het
Tnfrsf11a C A 1: 105,755,264 (GRCm39) N445K probably benign Het
Ttn G C 2: 76,540,514 (GRCm39) F34157L probably benign Het
Vmn2r91 C A 17: 18,356,424 (GRCm39) P697Q probably damaging Het
Zeb2 G A 2: 44,887,006 (GRCm39) L684F probably damaging Het
Zfp661 T C 2: 127,419,456 (GRCm39) D228G probably benign Het
Zfp738 T C 13: 67,821,147 (GRCm39) K77E probably damaging Het
Zkscan1 T A 5: 138,099,192 (GRCm39) D378E probably damaging Het
Zswim9 T A 7: 12,993,924 (GRCm39) D744V possibly damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CACTCTGGCATACCTAATATGTTGAC -3'
(R):5'- AGCATATGCATCTTCATGGCAG -3'

Sequencing Primer
(F):5'- CCGAGTGAATCTTTGCAAATGCC -3'
(R):5'- CATCTTCATGGCAGAAATGTGGGC -3'
Posted On 2019-06-26