Incidental Mutation 'R7178:Tgm5'
ID558743
Institutional Source Beutler Lab
Gene Symbol Tgm5
Ensembl Gene ENSMUSG00000053675
Gene Nametransglutaminase 5
Synonyms2310007C07Rik, TGx
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7178 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121046111-121085841 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 121085768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028721]
Predicted Effect probably benign
Transcript: ENSMUST00000028721
SMART Domains Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675

DomainStartEndE-ValueType
Pfam:Transglut_N 11 127 1.4e-31 PFAM
TGc 275 368 1.86e-49 SMART
Pfam:Transglut_C 511 610 2.5e-23 PFAM
Pfam:Transglut_C 624 722 1.8e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg1 A G 9: 54,628,461 I130T possibly damaging Het
Adam24 T A 8: 40,680,000 L169* probably null Het
Als2 A T 1: 59,207,812 I556N probably damaging Het
Ankrd44 A T 1: 54,649,440 N212K Het
Anpep T C 7: 79,840,988 D260G probably benign Het
Arhgap17 A T 7: 123,285,358 probably null Het
Atad2 C T 15: 58,117,293 R383Q probably damaging Het
Atp11b T A 3: 35,819,950 M696K probably benign Het
Atp13a2 A G 4: 140,999,151 T350A probably damaging Het
Atp8b2 T C 3: 89,943,672 D29G possibly damaging Het
Baz2a C T 10: 128,124,457 R1514W probably damaging Het
Cep250 T A 2: 155,973,455 L631* probably null Het
Clec4a3 T C 6: 122,964,292 I82T probably benign Het
Csmd3 T A 15: 47,590,774 I2648F Het
Cul5 A G 9: 53,644,526 F247L probably benign Het
D430042O09Rik T C 7: 125,866,327 V1317A probably benign Het
Dnajc24 A T 2: 105,970,462 M101K probably damaging Het
Dnhd1 T A 7: 105,694,993 V1848E probably damaging Het
Dspp A G 5: 104,174,066 T14A probably benign Het
Fam166a G A 2: 25,220,240 V55I probably damaging Het
Fam196b G T 11: 34,402,359 V134F probably damaging Het
Gm7298 T G 6: 121,785,896 I1392S probably damaging Het
Gm9955 A T 18: 24,709,163 S62R unknown Het
Gtsf1 T G 15: 103,419,961 N130T probably benign Het
Heatr5a C A 12: 51,925,142 S755I probably damaging Het
Hrc A G 7: 45,336,261 T279A possibly damaging Het
Hvcn1 T C 5: 122,233,510 W38R probably damaging Het
Hyal6 A G 6: 24,734,835 S256G probably benign Het
Ipo13 A G 4: 117,903,884 S546P possibly damaging Het
Kif24 A G 4: 41,395,085 V730A probably benign Het
L3mbtl2 T C 15: 81,671,074 V176A probably benign Het
Lgi1 T C 19: 38,306,285 Y502H probably damaging Het
Liph T A 16: 21,976,328 D178V probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mak16 A C 8: 31,166,574 S42A probably benign Het
Mamdc4 T C 2: 25,568,965 I269V probably benign Het
Mapk8ip3 A T 17: 24,901,754 M812K probably benign Het
Muc4 T A 16: 32,752,788 S889T unknown Het
Npy6r A G 18: 44,276,484 N324S probably damaging Het
Ntrk3 T G 7: 78,356,147 T489P possibly damaging Het
Olfr1102 G A 2: 87,002,535 V189I probably benign Het
Olfr187 T A 16: 59,035,933 D268V probably benign Het
Olfr69 G A 7: 103,767,975 Q141* probably null Het
Otof G C 5: 30,383,534 T887S possibly damaging Het
Papola T C 12: 105,807,184 V154A probably damaging Het
Pde4dip T C 3: 97,715,630 H1421R probably benign Het
Plpp5 T C 8: 25,720,579 S66P probably benign Het
Ppp6r3 T A 19: 3,518,337 I154L probably benign Het
Prr18 A C 17: 8,341,909 D299A possibly damaging Het
Psmb1 G A 17: 15,477,259 S198F possibly damaging Het
Qars T C 9: 108,515,123 V723A possibly damaging Het
Rab6a A T 7: 100,636,752 R185* probably null Het
Scn2a C T 2: 65,748,853 Q1511* probably null Het
Serpinb3d T A 1: 107,080,776 I120F possibly damaging Het
Serpini2 T C 3: 75,258,148 T175A probably damaging Het
Skiv2l T C 17: 34,839,464 T1226A probably benign Het
Slc17a6 A G 7: 51,667,511 I427V possibly damaging Het
Slc2a2 C T 3: 28,719,482 A312V possibly damaging Het
Snx33 C T 9: 56,925,867 R306H probably damaging Het
Spcs1 G A 14: 31,000,481 S127F possibly damaging Het
Speg T C 1: 75,422,383 V2158A possibly damaging Het
Sptbn4 T A 7: 27,418,056 I423F probably damaging Het
Synj2 T A 17: 6,026,479 I930N possibly damaging Het
Tas2r140 T A 6: 133,055,660 D45V probably damaging Het
Tcf3 C A 10: 80,421,599 V11F unknown Het
Tead1 A T 7: 112,841,937 Q91L probably benign Het
Tgoln1 C T 6: 72,616,045 G151S probably benign Het
Tnfrsf11a C A 1: 105,827,539 N445K probably benign Het
Ttn G C 2: 76,710,170 F34157L probably benign Het
Vmn2r91 C A 17: 18,136,162 P697Q probably damaging Het
Zeb2 G A 2: 44,996,994 L684F probably damaging Het
Zfp661 T C 2: 127,577,536 D228G probably benign Het
Zfp738 T C 13: 67,673,028 K77E probably damaging Het
Zkscan1 T A 5: 138,100,930 D378E probably damaging Het
Zswim9 T A 7: 13,259,997 D744V possibly damaging Het
Other mutations in Tgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tgm5 APN 2 121071496 missense probably benign 0.01
IGL01148:Tgm5 APN 2 121046675 splice site probably null
IGL01284:Tgm5 APN 2 121052547 missense possibly damaging 0.94
IGL01370:Tgm5 APN 2 121053537 missense probably benign 0.03
IGL01545:Tgm5 APN 2 121052808 missense probably damaging 1.00
IGL01547:Tgm5 APN 2 121049202 splice site probably benign
IGL01998:Tgm5 APN 2 121052439 missense probably damaging 1.00
IGL02577:Tgm5 APN 2 121077603 missense probably benign 0.01
IGL02636:Tgm5 APN 2 121076796 missense probably damaging 0.99
PIT4283001:Tgm5 UTSW 2 121071585 missense possibly damaging 0.48
R0001:Tgm5 UTSW 2 121077646 missense probably damaging 1.00
R0013:Tgm5 UTSW 2 121076882 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0117:Tgm5 UTSW 2 121075102 critical splice donor site probably null
R0145:Tgm5 UTSW 2 121077581 missense possibly damaging 0.93
R0356:Tgm5 UTSW 2 121053574 missense probably damaging 1.00
R0410:Tgm5 UTSW 2 121077558 missense possibly damaging 0.46
R0519:Tgm5 UTSW 2 121048895 missense probably damaging 1.00
R1674:Tgm5 UTSW 2 121071544 missense possibly damaging 0.60
R1773:Tgm5 UTSW 2 121077650 missense possibly damaging 0.67
R1864:Tgm5 UTSW 2 121075218 missense probably damaging 1.00
R2276:Tgm5 UTSW 2 121048823 splice site probably benign
R2511:Tgm5 UTSW 2 121076948 missense possibly damaging 0.62
R4180:Tgm5 UTSW 2 121076961 missense probably benign 0.13
R4230:Tgm5 UTSW 2 121070735 missense probably damaging 1.00
R4801:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R4802:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R5840:Tgm5 UTSW 2 121085660 critical splice donor site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R7064:Tgm5 UTSW 2 121053514 missense probably benign 0.04
R7102:Tgm5 UTSW 2 121046498 missense possibly damaging 0.89
R7114:Tgm5 UTSW 2 121048496 nonsense probably null
R7748:Tgm5 UTSW 2 121052808 missense probably damaging 1.00
RF022:Tgm5 UTSW 2 121071611 missense probably damaging 1.00
V3553:Tgm5 UTSW 2 121071502 missense probably damaging 1.00
X0065:Tgm5 UTSW 2 121070839 missense probably damaging 1.00
Z1177:Tgm5 UTSW 2 121052451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATCCTGAGGGCTCTTGG -3'
(R):5'- CCGAGAGCTATCGAAAGTCC -3'

Sequencing Primer
(F):5'- CCTGCCTAGATCAGCTTATTATTG -3'
(R):5'- CCGAGAGCTATCGAAAGTCCAATAG -3'
Posted On2019-06-26